Anti-CXCL8 / IL-8 Reference Antibody (ABX-IL8)
Product Name : Anti-CXCL8 / IL-8 Reference Antibody (ABX-IL8)synonym : null,productDescription : Anti-CXCL8 /...
Anti-CXCL12 / SDF1a Reference Antibody (Genentech anti-CXCL12)
Product Name : Anti-CXCL12 / SDF1a Reference Antibody (Genentech anti-CXCL12)synonym : null,productDescription : Anti-CXCL12...
Anti-CXCL10 / IP-10 Reference Antibody (NI-0801)
Product Name : Anti-CXCL10 / IP-10 Reference Antibody (NI-0801)synonym : null,productDescription : Anti-CXCL10 /...
Anti-IFNg Reference Antibody (fontolizumab)
Product Name : Anti-IFNg Reference Antibody (fontolizumab)synonym : null,productDescription : Anti-IFNg Reference Antibody (fontolizumab)(CHA780)...
Anti-CTLA-8 / IL-17a Reference Antibody (vunakizumab)
Product Name : Anti-CTLA-8 / IL-17a Reference Antibody (vunakizumab)synonym : null,productDescription : Anti-CTLA-8 /...
Anti-CTLA-8 / IL-17a Reference Antibody (UCB patent anti-IL-17)
Product Name : Anti-CTLA-8 / IL-17a Reference Antibody (UCB patent anti-IL-17)synonym : null,productDescription :...
Anti-CTLA-8 / IL-17a Reference Antibody (perakizumab)
Product Name : Anti-CTLA-8 / IL-17a Reference Antibody (perakizumab)synonym : null,productDescription : Anti-CTLA-8 /...
Anti-CDH1 / E-cadherin / CD324 Mouse mAb
Product Name : Anti-CDH1 / E-cadherin / CD324 Mouse mAbsynonym : null,productDescription : NonemolecularWeight...
Anti-CTLA-8 / IL-17a Reference Antibody (netakimab)
Product Name : Anti-CTLA-8 / IL-17a Reference Antibody (netakimab)synonym : null,productDescription : Anti-CTLA-8 /...
Anti-CTLA-8 / IL-17a Reference Antibody (ixekizumab)
Product Name : Anti-CTLA-8 / IL-17a Reference Antibody (ixekizumab)synonym : null,productDescription : Anti-CTLA-8 /...
Anti-CTLA-8 / IL-17a Reference Antibody (CAT-2200)
Product Name : Anti-CTLA-8 / IL-17a Reference Antibody (CAT-2200)synonym : null,productDescription : Anti-CTLA-8 /...
Anti-CTLA-4 / CD152 Reference Antibody (zalifrelimab)
Product Name : Anti-CTLA-4 / CD152 Reference Antibody (zalifrelimab)synonym : null,productDescription : Anti-CTLA-4 /...
Anti-CTLA-4 / CD152 Reference Antibody (tremelimumab)
Product Name : Anti-CTLA-4 / CD152 Reference Antibody (tremelimumab)synonym : null,productDescription : Anti-CTLA-4 /...
Anti-CTLA-4 / CD152 Reference Antibody (nurulimab)
Product Name : Anti-CTLA-4 / CD152 Reference Antibody (nurulimab)synonym : null,productDescription : Anti-CTLA-4 /...
Anti-TRP1 / TYRP1 Reference Antibody (flanvotumab)
Product Name : Anti-TRP1 / TYRP1 Reference Antibody (flanvotumab)synonym : null,productDescription : Anti-TRP1 /...
Anti-PDCD1 / PD-1 / CD279 Reference Antibody (finotonlimab)
Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (finotonlimab)synonym : null,productDescription :...
Anti-Sphingosine-1-phosphate Reference Antibody (Expression DD patent anti-SIP)
Product Name : Anti-Sphingosine-1-phosphate Reference Antibody (Expression DD patent anti-SIP)synonym : null,productDescription : Anti-Sphingosine-1-phosphate...
Anti-PCSK9 Reference Antibody (evolocumab)
Product Name : Anti-PCSK9 Reference Antibody (evolocumab)synonym : null,productDescription : Anti-PCSK9 Reference Antibody (evolocumab)(CHA762)...
Anti-DPC4 Rabbit mAb
Product Name : Anti-DPC4 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 60endotoxin : Nonepurity...
Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (etrolizumab)
Product Name : Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (etrolizumab)synonym : null,productDescription :...
Anti-CSF2 / GM-CSF Reference Antibody (namilumab)
Product Name : Anti-CSF2 / GM-CSF Reference Antibody (namilumab)synonym : null,productDescription : Anti-CSF2 /...
Anti-CSF2 / GM-CSF Reference Antibody (lenzilumab)
Product Name : Anti-CSF2 / GM-CSF Reference Antibody (lenzilumab)synonym : null,productDescription : Anti-CSF2 /...
Anti-CSF2 / GM-CSF Reference Antibody (gimsilumab)
Product Name : Anti-CSF2 / GM-CSF Reference Antibody (gimsilumab)synonym : productDescription : Anti-CSF2 /...
Anti-CSF1R / M-CSFR / CD115 Reference Antibody (LY3022855)
Product Name : Anti-CSF1R / M-CSFR / CD115 Reference Antibody (LY3022855)synonym : null,productDescription :...
Anti-CSF1R / M-CSFR / CD115 Reference Antibody (emactuzumab)
Product Name : Anti-CSF1R / M-CSFR / CD115 Reference Antibody (emactuzumab)synonym : null,productDescription :...
Anti-TNFSF2 / TNFa Reference Antibody (Epitomics patent anti-TNFα)
Product Name : Anti-TNFSF2 / TNFa Reference Antibody (Epitomics patent anti-TNFα)synonym : null,productDescription :...
Anti-Complement Factor D Reference Antibody (lampalizumab)
Product Name : Anti-Complement Factor D Reference Antibody (lampalizumab)synonym : null,productDescription : Anti-Complement Factor...
Anti-Complement C5aR1 Reference Antibody (G2 patent anti-C5aR)
Product Name : Anti-Complement C5aR1 Reference Antibody (G2 patent anti-C5aR)synonym : null,productDescription : Anti-Complement...
Anti-DLL4 Reference Antibody (enoticumab)
Product Name : Anti-DLL4 Reference Antibody (enoticumab)synonym : null,productDescription : Anti-DLL4 Reference Antibody (enoticumab)(CHA749)...
Anti-ANO1 / TMEM16ARabbit mAb
Product Name : Anti-ANO1 / TMEM16ARabbit mAbsynonym : null,productDescription : NonemolecularWeight : 114endotoxin :...
Anti-Complement C5 Reference Antibody (ravulizumab)
Product Name : Anti-Complement C5 Reference Antibody (ravulizumab)synonym : null,productDescription : Anti-Complement C5 Reference...
Anti-Complement C5 Reference Antibody (lendalizumab)
Product Name : Anti-Complement C5 Reference Antibody (lendalizumab)synonym : null,productDescription : Anti-Complement C5 Reference...
Anti-AXL / UFO Reference Antibody (enapotamab)
Product Name : Anti-AXL / UFO Reference Antibody (enapotamab)synonym : productDescription : Anti-AXL /...
Anti-CLEC4C Reference Antibody (LFB patent anti-BDCA-2)
Product Name : Anti-CLEC4C Reference Antibody (LFB patent anti-BDCA-2)synonym : null,productDescription : Anti-CLEC4C Reference...
Anti-CLEC4C Reference Antibody (BIIB059)
Product Name : Anti-CLEC4C Reference Antibody (BIIB059)synonym : null,productDescription : Anti-CLEC4C Reference Antibody (BIIB059)(CHA742)...
Anti-TNFRSF5 / CD40 Reference Antibody (Emory U. anti-CD40)
Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (Emory U. anti-CD40)synonym : null,productDescription :...
Anti-IL-6 / IFNb2 Reference Antibody (elsilimomab)
Product Name : Anti-IL-6 / IFNb2 Reference Antibody (elsilimomab)synonym : null,productDescription : Anti-IL-6 /...
Anti-CEACAM6 / CD66c Reference Antibody (tinurilimab)
Product Name : Anti-CEACAM6 / CD66c Reference Antibody (tinurilimab)synonym : null,productDescription : Anti-CEACAM6 /...
Anti-PCSK9 Reference Antibody (ebronucimab)
Product Name : Anti-PCSK9 Reference Antibody (ebronucimab)synonym : null,productDescription : Anti-PCSK9 Reference Antibody (ebronucimab)(CHA736)...
Anti-Desmin Mouse mAb
Product Name : Anti-Desmin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 54endotoxin : Nonepurity...
Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab)
Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab)synonym : null,productDescription :...
Anti-IL-12b Reference Antibody (ebdarokimab)
Product Name : Anti-IL-12b Reference Antibody (ebdarokimab)synonym : null,productDescription : Anti-IL-12b Reference Antibody (ebdarokimab)(CHA733)...
Anti-CEACAM5 / CEA / CD66e Reference Antibody (cergutuzumAb)
Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (cergutuzumAb)synonym : null,productDescription :...
Anti-CEACAM1 / CD66a Reference Antibody (Chaim Sheba Med. Cntr. patent anti-CEACAM1)
Product Name : Anti-CEACAM1 / CD66a Reference Antibody (Chaim Sheba Med. Cntr. patent anti-CEACAM1)synonym...
Anti-CDH3 / P-cadherin Reference Antibody (PF-03732010)
Product Name : Anti-CDH3 / P-cadherin Reference Antibody (PF-03732010)synonym : null,productDescription : Anti-CDH3 /...
Anti-CDH1 / E-cadherin / CD324 Reference Antibody (Stem Centrx patent anti-Cadherin-1)
Product Name : Anti-CDH1 / E-cadherin / CD324 Reference Antibody (Stem Centrx patent anti-Cadherin-1)synonym...
Anti-CD9 Reference Antibody (Genentech patent anti-CD9)
Product Name : Anti-CD9 Reference Antibody (Genentech patent anti-CD9)synonym : null,productDescription : Anti-CD9 Reference...
Anti-CD83 Reference Antibody (Genentech patent anti-CD83)
Product Name : Anti-CD83 Reference Antibody (Genentech patent anti-CD83)synonym : null,productDescription : Anti-CD83 Reference...
Anti-CD79b Reference Antibody (iladatuzumAb)
Product Name : Anti-CD79b Reference Antibody (iladatuzumAb)synonym : null,productDescription : Anti-CD79b Reference Antibody (iladatuzumAb)(CHA723)...
Anti-PDCD1 / PD-1 / CD279 Reference Antibody (dostarlimab)
Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (dostarlimab)synonym : null,productDescription :...
Anti-Cyclin D1 Rabbit mAb
Product Name : Anti-Cyclin D1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 34endotoxin :...
Anti-CD7 Reference Antibody (grisnilimAb)
Product Name : Anti-CD7 Reference Antibody (grisnilimAb)synonym : null,productDescription : Anti-CD7 Reference Antibody (grisnilimAb)(CHA721)...
Anti-Amyloid Beta Reference Antibody (donanemab)
Product Name : Anti-Amyloid Beta Reference Antibody (donanemab)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Anti-TIGIT Reference Antibody (domvanalimab)
Product Name : Anti-TIGIT Reference Antibody (domvanalimab)synonym : null,productDescription : Anti-TIGIT Reference Antibody (domvanalimab)(CHA719)...
Anti-CD59 Reference Antibody (Quark patent anti-CD59)
Product Name : Anti-CD59 Reference Antibody (Quark patent anti-CD59)synonym : null,productDescription : Anti-CD59 Reference...
Anti-CD52 Reference Antibody (gatralimab)
Product Name : Anti-CD52 Reference Antibody (gatralimab)synonym : null,productDescription : Anti-CD52 Reference Antibody (gatralimab)(CHA717)...
Anti-FOLR1 / FRA Reference Antibody (Dompe patent anti-FOLR1)
Product Name : Anti-FOLR1 / FRA Reference Antibody (Dompe patent anti-FOLR1)synonym : null,productDescription :...
Anti-VEGF Reference Antibody (Domantis patent anti-VEGF)
Product Name : Anti-VEGF Reference Antibody (Domantis patent anti-VEGF)synonym : null,productDescription : Anti-VEGF Reference...
Anti-CD47 Reference Antibody (urabrelimab)
Product Name : Anti-CD47 Reference Antibody (urabrelimab)synonym : null,productDescription : Anti-CD47 Reference Antibody (urabrelimab)(CHA714)...
Anti-CD47 Reference Antibody (ligufalimab)
Product Name : Anti-CD47 Reference Antibody (ligufalimab)synonym : null,productDescription : Anti-CD47 Reference Antibody (ligufalimab)(CHA712)...
Anti-CD47 Reference Antibody (letaplimab)
Product Name : Anti-CD47 Reference Antibody (letaplimab)synonym : null,productDescription : Anti-CD47 Reference Antibody (letaplimab)(CHA711)...
Anti-COX-2 Rabbit mAb
Product Name : Anti-COX-2 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 69endotoxin : Nonepurity...
Anti-CD20 / MS4A1 Reference Antibody (divozilimab)
Product Name : Anti-CD20 / MS4A1 Reference Antibody (divozilimab)synonym : null,productDescription : Anti-CD20 Reference...
Anti-Histone H1 Reference Antibody (derlotuximab)
Product Name : Anti-Histone H1 Reference Antibody (derlotuximab)synonym : null,productDescription : Anti-Histone H1 Reference...
Anti-IL-5 Reference Antibody (depemokimab)
Product Name : Anti-IL-5 Reference Antibody (depemokimab)synonym : null,productDescription : Anti-IL-5 Reference Antibody (depemokimab)(CHA708)...
Anti-CD4 Reference Antibody (TRX1)
Product Name : Anti-CD4 Reference Antibody (TRX1)synonym : null,productDescription : Anti-CD4 Reference Antibody (TRX1)(CHA707)...
Anti-CD4 Reference Antibody (tregalizumab)
Product Name : Anti-CD4 Reference Antibody (tregalizumab)synonym : null,productDescription : Anti-CD4 Reference Antibody (tregalizumab)(CHA706)...
Anti-CD4 Reference Antibody (ibalizumab)
Product Name : Anti-CD4 Reference Antibody (ibalizumab)synonym : null,productDescription : Anti-CD4 Reference Antibody (ibalizumab)(CHA704)...
Anti-CD38 Reference Antibody (mezagitamab)
Product Name : Anti-CD38 Reference Antibody (mezagitamab)synonym : null,productDescription : Anti-CD38 Reference Antibody (mezagitamab)(CHA703)...
Anti-CD38 Reference Antibody (isatuximab)
Product Name : Anti-CD38 Reference Antibody (isatuximab)synonym : null,productDescription : Anti-CD38 Reference Antibody (isatuximab)(CHA701)...
Anti-CD38 Reference Antibody (felzartamab)
Product Name : Anti-CD38 Reference Antibody (felzartamab)synonym : null,productDescription : Anti-CD38 Reference Antibody (felzartamab)(CHA700)...
Anti-CD34 Reference Antibody (ITRI patent anti-CD34)
Product Name : Anti-CD34 Reference Antibody (ITRI patent anti-CD34)synonym : null,productDescription : Anti-CD34 Reference...
Anti-Collagen Type IV Mouse mAb
Product Name : Anti-Collagen Type IV Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 161endotoxin...
Anti-CD3 Reference Antibody (visilizumab)
Product Name : Anti-CD3 Reference Antibody (visilizumab)synonym : null,productDescription : Anti-CD3 Reference Antibody (visilizumab)(CHA697)...
Anti-TNFSF5 / CD40L / CD154 Reference Antibody (dapirolizumab)
Product Name : Anti-TNFSF5 / CD40L / CD154 Reference Antibody (dapirolizumab)synonym : null,productDescription :...
Anti-IGF1R / CD221 Reference Antibody (dalotuzumab)
Product Name : Anti-IGF1R / CD221 Reference Antibody (dalotuzumab)synonym : null,productDescription : Anti-IGF1R /...
Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (cudarolimab)
Product Name : Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (cudarolimab)synonym : null,productDescription :...
Anti-Complement C5 Reference Antibody (crovalimab)
Product Name : Anti-Complement C5 Reference Antibody (crovalimab)synonym : null,productDescription : Anti-Complement C5 Reference...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (cosibelimab)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (cosibelimab)synonym : null,productDescription :...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (coprelotamab)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (coprelotamab)synonym : null,productDescription :...
Anti-CD28L / CD80 Reference Antibody (galiximab)
Product Name : Anti-CD28L / CD80 Reference Antibody (galiximab)synonym : null,productDescription : Anti-CD28L /...
Anti-CD28 Reference Antibody (FR104)
Product Name : Anti-CD28 Reference Antibody (FR104)synonym : null,productDescription : Anti-CD28 Reference Antibody (FR104)(CHA679)...
Anti-CD20 / MS4A1 Reference Antibody (zuberitamab)
Product Name : Anti-CD20 / MS4A1 Reference Antibody (zuberitamab)synonym : null,productDescription : Anti-CD20 Reference...
Anti-c-MYC Rabbit mAb
Product Name : Anti-c-MYC Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 49endotoxin : Nonepurity...
Anti-Alpha-1-Fetoprotein Rabbit mAb
Product Name : Anti-Alpha-1-Fetoprotein Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 69 kDaendotoxin :...
Anti-CD20 / MS4A1 Reference Antibody (veltuzumab)
Product Name : Anti-CD20 / MS4A1 Reference Antibody (veltuzumab)synonym : null,productDescription : Anti-CD20 Reference...
Anti-CD20 / MS4A1 Reference Antibody (ublituximab)
Product Name : Anti-CD20 / MS4A1 Reference Antibody (ublituximab)synonym : null,productDescription : Anti-CD20 Reference...
Anti-CD20 / MS4A1 Reference Antibody (TRU-015)
Product Name : Anti-CD20 / MS4A1 Reference Antibody (TRU-015)synonym : null,productDescription : Anti-CD20 Reference...
Anti-CD20 / MS4A1 Reference Antibody (ripertamab)
Product Name : Anti-CD20 / MS4A1 Reference Antibody (ripertamab)synonym : null,productDescription : Anti-CD20 Reference...
Anti-TFPI Reference Antibody (concizumab)
Product Name : Anti-TFPI Reference Antibody (concizumab)synonym : null,productDescription : Anti-TFPI Reference Antibody (concizumab)(CHA669)...
Anti-CD19 Reference Antibody (coltuximab)
Product Name : Anti-CD19 Reference Antibody (coltuximab)synonym : null,productDescription : Anti-CD19 Reference Antibody (coltuximab)(CHA668)...
Anti-PTK7 / CCK4 Reference Antibody (cofetuzumab)
Product Name : Anti-PTK7 / CCK4 Reference Antibody (cofetuzumab)synonym : null,productDescription : Anti-PTK7 /...
Anti-TIM-3 / HAVCR2 / CD366 Reference Antibody (cobolimab)
Product Name : Anti-TIM-3 / HAVCR2 / CD366 Reference Antibody (cobolimab)synonym : null,productDescription :...
Anti-TLR3 / CD283 Reference Antibody (CNTO5429)
Product Name : Anti-TLR3 / CD283 Reference Antibody (CNTO5429)synonym : null,productDescription : Anti-TLR3 /...
Anti-IL-13 Reference Antibody (CNTO 607)
Product Name : Anti-IL-13 Reference Antibody (CNTO 607)synonym : null,productDescription : Anti-IL-13 Reference Antibody...
Anti-HGFR / c-Met Rabbit mAb
Product Name : Anti-HGFR / c-Met Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 156endotoxin...
Anti-Amyloid Beta Reference Antibody (CNTO 2125)
Product Name : Anti-Amyloid Beta Reference Antibody (CNTO 2125)synonym : null,productDescription : Anti-Amyloid Beta...
Anti-IFNa1 Reference Antibody (Chinese CDC patent anti-Interferon Alpha)
Product Name : Anti-IFNa1 Reference Antibody (Chinese CDC patent anti-Interferon Alpha)synonym : null,productDescription :...
Anti-CD2 Reference Antibody (siplizumab)
Product Name : Anti-CD2 Reference Antibody (siplizumab)synonym : null,productDescription : Anti-CD2 Reference Antibody (siplizumab)(CHA659)...
Anti-TNFSF2 / TNFa Reference Antibody (certolizumAb)
Product Name : Anti-TNFSF2 / TNFa Reference Antibody (certolizumAb)synonym : null,productDescription : Anti-TNFSF2 /...
Anti-CD19 Reference Antibody (Duke U. patent anti-CD19)
Product Name : Anti-CD19 Reference Antibody (Duke U. patent anti-CD19)synonym : null,productDescription : Anti-CD19...
Anti-IL-25 Reference Antibody (Centocor patent anti-IL-25)
Product Name : Anti-IL-25 Reference Antibody (Centocor patent anti-IL-25)synonym : null,productDescription : Anti-IL-25 Reference...
Anti-CD19 Reference Antibody (denintuzumab)
Product Name : Anti-CD19 Reference Antibody (denintuzumab)synonym : null,productDescription : Anti-CD19 Reference Antibody (denintuzumab)(CHA653)...
Anti-EMMPRIN / CD147 Reference Antibody (Centocor patent anti-CD147)
Product Name : Anti-EMMPRIN / CD147 Reference Antibody (Centocor patent anti-CD147)synonym : null,productDescription :...
Anti-CD151 Reference Antibody (Pierre Fabre patent anti-CD151)
Product Name : Anti-CD151 Reference Antibody (Pierre Fabre patent anti-CD151)synonym : null,productDescription : Anti-CD151...
Anti-CCL5 / RANTES Reference Antibody (NI-0701)
Product Name : Anti-CCL5 / RANTES Reference Antibody (NI-0701)synonym : null,productDescription : Anti-CCL5 /...
Anti-CK20 Rabbit mAb
Product Name : Anti-CK20 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 48endotoxin : Nonepurity...
Anti-CCL2 / MCP1 Reference Antibody (carlumab)
Product Name : Anti-CCL2 / MCP1 Reference Antibody (carlumab)synonym : null,productDescription : Anti-CCL2 /...
Anti-CB1 / CNR1 Reference Antibody (nimacimab)
Product Name : Anti-CB1 / CNR1 Reference Antibody (nimacimab)synonym : productDescription : Anti-CB1 /...
Anti-ABCB5 Reference Antibody (Brigham and Women’s patent anti-ABCB5)
Product Name : Anti-ABCB5 Reference Antibody (Brigham and Women’s patent anti-ABCB5)synonym : null,productDescription :...
Anti-CALCA / CGRP Reference Antibody (galcanezumab)
Product Name : Anti-CALCA / CGRP Reference Antibody (galcanezumab)synonym : null,productDescription : Anti-CALCA /...
Anti-CALCA / CGRP Reference Antibody (fremanezumab)
Product Name : Anti-CALCA / CGRP Reference Antibody (fremanezumab)synonym : null,productDescription : Anti-CALCA /...
Anti-CALCA / CGRP Reference Antibody (eptinezumab)
Product Name : Anti-CALCA / CGRP Reference Antibody (eptinezumab)synonym : null,productDescription : Anti-CALCA /...
Anti-PCSK9 Reference Antibody (Boehringer anti-PCSK9)
Product Name : Anti-PCSK9 Reference Antibody (Boehringer anti-PCSK9)synonym : null,productDescription : Anti-PCSK9 Reference Antibody...
Anti-PCSK9 Reference Antibody (bococizumab)
Product Name : Anti-PCSK9 Reference Antibody (bococizumab)synonym : null,productDescription : Anti-PCSK9 Reference Antibody (bococizumab)(CHA636)...
Anti-SOST / Sclerostin Reference Antibody (blosozumab)
Product Name : Anti-SOST / Sclerostin Reference Antibody (blosozumab)synonym : null,productDescription : Anti-SOST /...
Anti-BACE1 Reference Antibody (Genentech anti-BACE1)
Product Name : Anti-BACE1 Reference Antibody (Genentech anti-BACE1)synonym : null,productDescription : Anti-BACE1 Reference Antibody...
Anti-CK19 Rabbit mAb
Product Name : Anti-CK19 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 44endotoxin : Nonepurity...
Anti-B7-H4 / VTCN1 Reference Antibody (Millennium patent anti-B7-H4)
Product Name : Anti-B7-H4 / VTCN1 Reference Antibody (Millennium patent anti-B7-H4)synonym : null,productDescription :...
Anti-B7-H4 / VTCN1 Reference Antibody (alsevalimab)
Product Name : Anti-B7-H4 / VTCN1 Reference Antibody (alsevalimab)synonym : productDescription : Anti-B7-H4 /...
Anti-B7-H3 / CD276 Reference Antibody (Trellis patent anti-B7-H3)
Product Name : Anti-B7-H3 / CD276 Reference Antibody (Trellis patent anti-B7-H3)synonym : null,productDescription :...
Anti-B7-H2 / ICOSL / CD275 Reference Antibody (prezalumab)
Product Name : Anti-B7-H2 / ICOSL / CD275 Reference Antibody (prezalumab)synonym : null,productDescription :...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (sugemalimab)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (sugemalimab)synonym : null,productDescription :...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (sudubrilimab)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (sudubrilimab)synonym : null,productDescription :...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (pacmilimab)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (pacmilimab)synonym : null,productDescription :...
Anti-DPP4 / CD26 Reference Antibody (begelomab)
Product Name : Anti-DPP4 / CD26 Reference Antibody (begelomab)synonym : null,productDescription : Anti-DPP4 /...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (manelimab)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (manelimab)synonym : null,productDescription :...
Anti-TFPI Reference Antibody (befovacimab)
Product Name : Anti-TFPI Reference Antibody (befovacimab)synonym : null,productDescription : Anti-TFPI Reference Antibody (befovacimab)(CHA615)...
Anti-CK18 Rabbit mAb
Product Name : Anti-CK18 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 48endotoxin : Nonepurity...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (garivulimab)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (garivulimab)synonym : null,productDescription :...
Anti-IFNa1 Reference Antibody (Baylor patent anti-IFN alpha)
Product Name : Anti-IFNa1 Reference Antibody (Baylor patent anti-IFN alpha)synonym : null,productDescription : Anti-IFNa1...
Anti-FcRn (FCGRT & B2M) Reference Antibody (batoclimab)
Product Name : Anti-FcRn (FCGRT & B2M) Reference Antibody (batoclimab)synonym : null,productDescription : Anti-FcRn...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (adebrelimab)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (adebrelimab)synonym : null,productDescription :...
Anti-AXL / UFO Reference Antibody (tilvestamab)
Product Name : Anti-AXL / UFO Reference Antibody (tilvestamab)synonym : productDescription : Anti-AXL /...
Anti-MSPR / RON / CD136 Reference Antibody (Aveo anti-RON)
Product Name : Anti-MSPR / RON / CD136 Reference Antibody (Aveo anti-RON)synonym : null,productDescription...
Anti-Complement C5aR1 Reference Antibody (avdoralimab)
Product Name : Anti-Complement C5aR1 Reference Antibody (avdoralimab)synonym : null,productDescription : Anti-Complement C5aR1 Reference...
Anti-IL-1RL1 / ST2 / IL-33R Reference Antibody (astegolimab)
Product Name : Anti-IL-1RL1 / ST2 / IL-33R Reference Antibody (astegolimab)synonym : null,productDescription :...
Anti-ANGPTL4 Reference Antibody (Nanyang Tech.U. patent anti-ANGPTL4)
Product Name : Anti-ANGPTL4 Reference Antibody (Nanyang Tech.U. patent anti-ANGPTL4)synonym : null,productDescription : Anti-ANGPTL4...
Anti-ANGPT2 Reference Antibody (zansecimab)
Product Name : Anti-ANGPT2 Reference Antibody (zansecimab)synonym : null,productDescription : Anti-ANGPT2 Reference Antibody (zansecimab)(CHA602)...
Anti-CK17 Mouse mAb
Product Name : Anti-CK17 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 48endotoxin : Nonepurity...
Anti-GDF8 / Myostatin Reference Antibody (apitegromab)
Product Name : Anti-GDF8 / Myostatin Reference Antibody (apitegromab)synonym : null,productDescription : Anti-GDF8 /...
Anti-ANGPT2 Reference Antibody (MEDI3617)
Product Name : Anti-ANGPT2 Reference Antibody (MEDI3617)synonym : null,productDescription : Anti-ANGPT2 Reference Antibody (MEDI3617)(CHA600)...
Anti-Amyloid Beta Reference Antibody (Amgen patent anti-beta amyloid)
Product Name : Anti-Amyloid Beta Reference Antibody (Amgen patent anti-beta amyloid)synonym : null,productDescription :...
Anti-ICOS / CD278 Reference Antibody (alomfilimab)
Product Name : Anti-ICOS / CD278 Reference Antibody (alomfilimab)synonym : productDescription : Anti-ICOS /...
Anti-vWF Reference Antibody (Ajinomoto patent anti-vWF)
Product Name : Anti-vWF Reference Antibody (Ajinomoto patent anti-vWF)synonym : null,productDescription : Anti-vWF Reference...
Anti-Amyloid Beta Reference Antibody (GSK 933776)
Product Name : Anti-Amyloid Beta Reference Antibody (GSK 933776)synonym : null,productDescription : Anti-Amyloid Beta...
Anti-Cdiff Toxin A Reference Antibody (actoxumab)
Product Name : Anti-Cdiff Toxin A Reference Antibody (actoxumab)synonym : null,productDescription : Anti-Cdiff Toxin...
Anti-Amyloid Beta Reference Antibody (gantenerumab)
Product Name : Anti-Amyloid Beta Reference Antibody (gantenerumab)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Anti-ACVR2B Reference Antibody (Acceleron patent anti-ActRIIB)
Product Name : Anti-ACVR2B Reference Antibody (Acceleron patent anti-ActRIIB)synonym : null,productDescription : Anti-ACVR2B Reference...
Anti-Amyloid Beta Reference Antibody (DLX212)
Product Name : Anti-Amyloid Beta Reference Antibody (DLX212)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Anti-CK14 Mouse mAb
Product Name : Anti-CK14 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 52endotoxin : Nonepurity...
Anti-Amyloid Beta Reference Antibody (crenezumab)
Product Name : Anti-Amyloid Beta Reference Antibody (crenezumab)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Anti-VEGFR1 / FLT1 Reference Antibody (Abbott patent anti-Flt1)
Product Name : Anti-VEGFR1 / FLT1 Reference Antibody (Abbott patent anti-Flt1)synonym : null,productDescription :...
Anti-Amyloid Beta Reference Antibody (aducanumab)
Product Name : Anti-Amyloid Beta Reference Antibody (aducanumab)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Anti-Amyloid Alpha Reference Antibody (birtamimab)
Product Name : Anti-Amyloid Alpha Reference Antibody (birtamimab)synonym : null,productDescription : Anti-Amyloid Alpha Reference...
Anti-MUC16 Reference Antibody (abagovomab)
Product Name : Anti-MUC16 Reference Antibody (abagovomab)synonym : null,productDescription : Anti-MUC16 Reference Antibody (abagovomab)(CHA581)...
Anti-TNFSF4 / OX40L / CD252 Reference Antibody (amlitelimab)
Product Name : Anti-TNFSF4 / OX40L / CD252 Reference Antibody (amlitelimab)synonym : null,productDescription :...
Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (abrilumab)
Product Name : Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (abrilumab)synonym : null,productDescription :...
Anti-Siglec-3 / CD33 Reference Antibody (lintuzumAb)
Product Name : Anti-Siglec-3 / CD33 Reference Antibody (lintuzumAb)synonym : null,productDescription : Anti-Siglec-3 /...
Anti-TNFRSF5 / CD40 Reference Antibody (selicrelumab)
Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (selicrelumab)synonym : productDescription : Anti-TNFRSF5 /...
Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (drozitumab)
Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (drozitumab)synonym : null,productDescription :...
Anti-CK10 Mouse mAb
Product Name : Anti-CK10 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 59endotoxin : Nonepurity...
Anti-CCR5 / CD195 Reference Antibody (leronlimab)
Product Name : Anti-CCR5 / CD195 Reference Antibody (leronlimab)synonym : null,productDescription : Anti-CCR5 /...
Anti-TLR7 Reference Antibody (U.Tokyo patent anti-TLR7)
Product Name : Anti-TLR7 Reference Antibody (U.Tokyo patent anti-TLR7)synonym : null,productDescription : Anti-TLR7 Reference...
Anti-SCN11a / Nav1.9 Reference Antibody (Wuhan U. patent anti-Nav1.9)
Product Name : Anti-SCN11a / Nav1.9 Reference Antibody (Wuhan U. patent anti-Nav1.9)synonym : null,productDescription...
Anti-CDH11 / Cadherin-11 Reference Antibody (RG6125)
Product Name : Anti-CDH11 / Cadherin-11 Reference Antibody (RG6125)synonym : null,productDescription : Anti-CDH11 /...
Anti-TREM1 / CD354 Reference Antibody (PY159)
Product Name : Anti-TREM1 / CD354 Reference Antibody (PY159)synonym : null,productDescription : Anti-TREM1 /...
Anti-GFRA3 Reference Antibody (nadecnemab)
Product Name : Anti-GFRA3 Reference Antibody (nadecnemab)synonym : null,productDescription : Anti-GFRA3 Reference Antibody (nadecnemab)(CHA562)...
Anti-PAR2 Reference Antibody (PAR650097)
Product Name : Anti-PAR2 Reference Antibody (PAR650097)synonym : null,productDescription : Anti-PAR2 Reference Antibody (PAR650097)(CHA560)...
Anti-Complement C5 Reference Antibody (eculizumab)
Product Name : Anti-Complement C5 Reference Antibody (eculizumab)synonym : null,productDescription : Anti-Complement C5 Reference...
Anti-MICA Reference Antibody (CLN-619)
Product Name : Anti-MICA Reference Antibody (CLN-619)synonym : null,productDescription : Anti-MICA Reference Antibody (CLN-619)(CHA556)...
Anti-MUSK Reference Antibody (Argenx patent anti-MuSK)
Product Name : Anti-MUSK Reference Antibody (Argenx patent anti-MuSK)synonym : null,productDescription : Anti-MUSK Reference...
Anti-CK8 Mouse mAb
Product Name : Anti-CK8 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 54endotoxin : Nonepurity...
Anti-CD3e Reference Antibody (teplizumab)
Product Name : Anti-CD3e Reference Antibody (teplizumab)synonym : null,productDescription : Anti-CD3e Reference Antibody (teplizumab)(CHA553)...
Anti-CD59 Reference Antibody ( Mellitus patent anti-CD59)
Product Name : Anti-CD59 Reference Antibody ( Mellitus patent anti-CD59)synonym : null,productDescription : Anti-CD59...
Anti-TSHR Reference Antibody (K1-70)
Product Name : Anti-TSHR Reference Antibody (K1-70)synonym : null,productDescription : Anti-TSHR Reference Antibody (K1-70)(CHA548)...
Anti-KLK2 / Kallikrein 2 Reference Antibody (JNJ-69086420)
Product Name : Anti-KLK2 / Kallikrein 2 Reference Antibody (JNJ-69086420)synonym : null,productDescription : Anti-KLK2...
Anti-DSG3 Reference Antibody (Forerunner patent anti-DSG3)
Product Name : Anti-DSG3 Reference Antibody (Forerunner patent anti-DSG3)synonym : null,productDescription : Anti-DSG3 Reference...
Anti-IL-13 Reference Antibody (tralokinumab)
Product Name : Anti-IL-13 Reference Antibody (tralokinumab)synonym : null,productDescription : Anti-IL-13 Reference Antibody (tralokinumab)(CHA539)...
Anti-CTLA-8 / IL-17a Reference Antibody (secukinumab)
Product Name : Anti-CTLA-8 / IL-17a Reference Antibody (secukinumab)synonym : null,productDescription : Anti-CTLA-8 /...
Anti-HLA-DR Reference Antibody (IMMU-114)
Product Name : Anti-HLA-DR Reference Antibody (IMMU-114)synonym : null,productDescription : Anti-HLA-DR Reference Antibody (IMMU-114)(CHA534)...
Anti-LYPD3 / C4.4A Reference Antibody (lupartumab)
Product Name : Anti-LYPD3 / C4.4A Reference Antibody (lupartumab)synonym : null,productDescription : Anti-LYPD3 /...
Anti-SLAMF6 / CD352 Reference Antibody (SGN-CD352A)
Product Name : Anti-SLAMF6 / CD352 Reference Antibody (SGN-CD352A)synonym : null,productDescription : Anti-SLAMF6 /...
Anti-CK7 Mouse mAb
Product Name : Anti-CK7 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 51endotoxin : Nonepurity...
Anti-NOTCH3 Reference Antibody (tarextumab)
Product Name : Anti-NOTCH3 Reference Antibody (tarextumab)synonym : null,productDescription : Anti-NOTCH3 Reference Antibody (tarextumab)(CHA531)...
Anti-SCFR / c-Kit / CD117 Reference Antibody (CDX-0158)
Product Name : Anti-SCFR / c-Kit / CD117 Reference Antibody (CDX-0158)synonym : null,productDescription :...
Anti-TNFSF7 / CD27L / CD70 Reference Antibody (cusatuzumab)
Product Name : Anti-TNFSF7 / CD27L / CD70 Reference Antibody (cusatuzumab)synonym : null,productDescription :...
Anti-EFNA4 Reference Antibody (PF-06647263)
Product Name : Anti-EFNA4 Reference Antibody (PF-06647263)synonym : null,productDescription : Anti-EFNA4 Reference Antibody (PF-06647263)(CHA528)...
Anti-LAMP1 / CD107a Reference Antibody ( SAR428926)
Product Name : Anti-LAMP1 / CD107a Reference Antibody ( SAR428926)synonym : null,productDescription : Anti-LAMP1...
Anti-SLITRK6 Reference Antibody (sirtratumab)
Product Name : Anti-SLITRK6 Reference Antibody (sirtratumab)synonym : null,productDescription : Anti-SLITRK6 Reference Antibody (sirtratumab)(CHA526)...
Anti-SLC44A4 Reference Antibody (ASG-5ME)
Product Name : Anti-SLC44A4 Reference Antibody (ASG-5ME)synonym : null,productDescription : Anti-SLC44A4 Reference Antibody (ASG-5ME)(CHA525)...
Anti-LRRC15 / LIB Reference Antibody (samrotamab)
Product Name : Anti-LRRC15 / LIB Reference Antibody (samrotamab)synonym : null,productDescription : Anti-LRRC15 /...
Anti-ETBR Reference Antibody (DEDN6526A)
Product Name : Anti-ETBR Reference Antibody (DEDN6526A)synonym : null,productDescription : Anti-ETBR Reference Antibody (DEDN6526A)(CHA523)...
Anti- FcRH5 / IRTA2 / CD307e Reference Antibody (cevostamab)
Product Name : Anti- FcRH5 / IRTA2 / CD307e Reference Antibody (cevostamab)synonym : productDescription...
Anti-CK (pan) Mouse mAb
Product Name : Anti-CK (pan) Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 66endotoxin :...
Anti-ALK Mouse mAb
Product Name : Anti-ALK Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 176 kDaendotoxin :...
Anti-PRLR / Prolactin Receptor Reference Antibody (rolinsatamab)
Product Name : Anti-PRLR / Prolactin Receptor Reference Antibody (rolinsatamab)synonym : null,productDescription : Anti-PRLR...
Anti-GD3 Reference Antibody (ecromeximab)
Product Name : Anti-GD3 Reference Antibody (ecromeximab)synonym : null,productDescription : Anti-GD3 Reference Antibody (ecromeximab)(CHA519)...
Anti-Integrin a11 / ITAG11 Reference Antibody (Scripps patent anti-CD11a)
Product Name : Anti-Integrin a11 / ITAG11 Reference Antibody (Scripps patent anti-CD11a)synonym : null,productDescription...
Anti-GPC1 / Glypican-1 Reference Antibody (Minomic patent anti-Glypican 1)
Product Name : Anti-GPC1 / Glypican-1 Reference Antibody (Minomic patent anti-Glypican 1)synonym : null,productDescription...
Anti-CD44v6 Reference Antibody (bivatuzumab)
Product Name : Anti-CD44v6 Reference Antibody (bivatuzumab)synonym : null,productDescription : Anti-CD44v6 Reference Antibody (bivatuzumab)(CHA511)...
Anti-DPEP3 Reference Antibody (tamrintamab)
Product Name : Anti-DPEP3 Reference Antibody (tamrintamab)synonym : null,productDescription : Anti-DPEP3 Reference Antibody (tamrintamab)(CHA510)...
Anti-MUC1 Reference Antibody (cantuzumab)
Product Name : Anti-MUC1 Reference Antibody (cantuzumab)synonym : null,productDescription : Anti-MUC1 Reference Antibody (cantuzumab)(CHA509)...
Anti-c-RET Reference Antibody (Regeneron patent anti-RET)
Product Name : Anti-c-RET Reference Antibody (Regeneron patent anti-RET)synonym : null,productDescription : Anti-c-RET Reference...
Anti-TMEFF1 / Tomoregulin-1 Reference Antibody (Bluefin patent anti-TMEFF1)
Product Name : Anti-TMEFF1 / Tomoregulin-1 Reference Antibody (Bluefin patent anti-TMEFF1)synonym : null,productDescription :...
Anti-Dysadherin Reference Antibody (Centrose patent anti-dysadherin)
Product Name : Anti-Dysadherin Reference Antibody (Centrose patent anti-dysadherin)synonym : null,productDescription : Anti-Dysadherin Reference...
Anti-CK (LMW) Mouse mAb
Product Name : Anti-CK (LMW) Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 66endotoxin :...
Anti-158P1D7 Reference Antibody (Agensys patent anti-158P1D7)
Product Name : Anti-158P1D7 Reference Antibody (Agensys patent anti-158P1D7)synonym : null,productDescription : Anti-158P1D7 Reference...
Anti-PTGFRN / CD315 Reference Antibody (AG02-ADC)
Product Name : Anti-PTGFRN / CD315 Reference Antibody (AG02-ADC)synonym : null,productDescription : Anti-PTGFRN /...
Anti-MRC2 / CD280 Reference Antibody (Copenhagen Rigshospitalet patent anti-uPARAP)
Product Name : Anti-MRC2 / CD280 Reference Antibody (Copenhagen Rigshospitalet patent anti-uPARAP)synonym : null,productDescription...
Anti-Matriptase Reference Antibody (Oxford Bio patent anti-Matriptase)
Product Name : Anti-Matriptase Reference Antibody (Oxford Bio patent anti-Matriptase)synonym : null,productDescription : Anti-Matriptase...
Anti-TEM1 / Endosialin / CD248 Reference Antibody (ontuxizumab)
Product Name : Anti-TEM1 / Endosialin / CD248 Reference Antibody (ontuxizumab)synonym : null,productDescription :...
Anti-DLK1 Reference Antibody (LIV-1205)
Product Name : Anti-DLK1 Reference Antibody (LIV-1205)synonym : null,productDescription : Anti-DLK1 Reference Antibody (LIV-1205)(CHA494)...
Anti-PLAUR / uPAR / CD87 Reference Antibody (ATN-658)
Product Name : Anti-PLAUR / uPAR / CD87 Reference Antibody (ATN-658)synonym : null,productDescription :...
Anti-CD98 Reference Antibody (KHK2898)
Product Name : Anti-CD98 Reference Antibody (KHK2898)synonym : null,productDescription : Anti-CD98 Reference Antibody (KHK2898)(CHA492)...
Anti-KAAG1 Reference Antibody (ADCT-901)
Product Name : Anti-KAAG1 Reference Antibody (ADCT-901)synonym : null,productDescription : Anti-KAAG1 Reference Antibody (ADCT-901)(CHA491)...
Anti-Ly6E Reference Antibody (RG7841)
Product Name : Anti-Ly6E Reference Antibody (RG7841)synonym : null,productDescription : Anti-Ly6E Reference Antibody (RG7841)(CHA486)...
Anti-CK (HMW) Mouse mAb
Product Name : Anti-CK (HMW) Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 66endotoxin :...
Anti-CD28 Reference Antibody (lulizumab)
Product Name : Anti-CD28 Reference Antibody (lulizumab)synonym : productDescription : Lulizumab is a monovalent...
Anti-IL-1b Reference Antibody (canakinumab)
Product Name : Anti-IL-1b Reference Antibody (canakinumab)synonym : null,productDescription : Anti-IL-1b Reference Antibody (canakinumab)(CHA483)...
Anti-CD163 Reference Antibody (OR2805)
Product Name : Anti-CD163 Reference Antibody (OR2805)synonym : null,productDescription : Anti-CD163 Reference Antibody (OR2805)(CHA479)...
Anti-TPBG Reference Antibody (PF-06263507)
Product Name : Anti-TPBG Reference Antibody (PF-06263507)synonym : null,productDescription : Anti-TPBG Reference Antibody (PF-06263507)(CHA478)...
Anti-HTRA1 Reference Antibody (FHTR2163)
Product Name : Anti-HTRA1 Reference Antibody (FHTR2163)synonym : null,productDescription : Anti-HTRA1 Reference Antibody (FHTR2163)(CHA475)...
Anti-CXC-ELR Reference Antibody (Lilly patent anti-Pan-ELR+)
Product Name : Anti-CXC-ELR Reference Antibody (Lilly patent anti-Pan-ELR+)synonym : null,productDescription : Anti-CXC-ELR Reference...
Anti-ANGPTL8 Reference Antibody (Regeneron patent anti-ANGPTL8)
Product Name : Anti-ANGPTL8 Reference Antibody (Regeneron patent anti-ANGPTL8)synonym : null,productDescription : Anti-ANGPTL8 Reference...
Anti-RG1 Reference Antibody (19G9)
Product Name : Anti-RG1 Reference Antibody (19G9)synonym : null,productDescription : Anti-RG1 Reference Antibody (19G9)(CHA472)...
Anti-Histone H4 Reference Antibody (Immunomedics patent anti-Histone H4)
Product Name : Anti-Histone H4 Reference Antibody (Immunomedics patent anti-Histone H4)synonym : null,productDescription :...
Anti-Histone H3 Reference Antibody (Immunomedics patent anti-Histone H3)
Product Name : Anti-Histone H3 Reference Antibody (Immunomedics patent anti-Histone H3)synonym : null,productDescription :...
Anti-Chromogranin Mouse mAb
Product Name : Anti-Chromogranin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 51endotoxin : Nonepurity...
Anti-Histone H2B Reference Antibody (Immunomedics patent anti-Histone H2B)
Product Name : Anti-Histone H2B Reference Antibody (Immunomedics patent anti-Histone H2B)synonym : null,productDescription :...
Anti-Integrin b7 / ITGB7 Reference Antibody (Genentech patent anti-Integrin β7)
Product Name : Anti-Integrin b7 / ITGB7 Reference Antibody (Genentech patent anti-Integrin β7)synonym :...
Anti-SCN9a / Nav1.7 Reference Antibody (Duke anti-NAv1.7)
Product Name : Anti-SCN9a / Nav1.7 Reference Antibody (Duke anti-NAv1.7)synonym : null,productDescription : Anti-SCN9a...
Anti-Polyubiquitin Reference Antibody (Genentech patent anti-Polyubiquitin)
Product Name : Anti-Polyubiquitin Reference Antibody (Genentech patent anti-Polyubiquitin)synonym : null,productDescription : Anti-Polyubiquitin Reference...
Anti-ANO1 / TMEM16A Reference Antibody (Novartis patent anti-TMEM16A \t)
Product Name : Anti-ANO1 / TMEM16A Reference Antibody (Novartis patent anti-TMEM16A \t)synonym : null,productDescription...
Anti-TIE2 / CD202b Reference Antibody (Regeneron patent anti-TIE-2)
Product Name : Anti-TIE2 / CD202b Reference Antibody (Regeneron patent anti-TIE-2)synonym : null,productDescription :...
Anti-TMEFF2 Reference Antibody (Janssen patent anti-TMEFF2)
Product Name : Anti-TMEFF2 Reference Antibody (Janssen patent anti-TMEFF2)synonym : null,productDescription : Anti-TMEFF2 Reference...
Anti-STOP1 Reference Antibody (Genentech patent anti-STOP-1)
Product Name : Anti-STOP1 Reference Antibody (Genentech patent anti-STOP-1)synonym : null,productDescription : Anti-STOP1 Reference...
Anti-Albumin Reference Antibody (Numab patent anti-HSA)
Product Name : Anti-Albumin Reference Antibody (Numab patent anti-HSA)synonym : null,productDescription : Anti-Albumin Reference...
Anti-GPR73 / PROKR1 Reference Antibody (Multiple seq-one in animal)
Product Name : Anti-GPR73 / PROKR1 Reference Antibody (Multiple seq-one in animal)synonym : null,productDescription...
Anti-CEACAM5 / CEA / CD66e Mouse mAb
Product Name : Anti-CEACAM5 / CEA / CD66e Mouse mAbsynonym : null,productDescription : NonemolecularWeight...
Anti-CXCL4 / PF4 Reference Antibody (U.Penn. patent anti-PF4)
Product Name : Anti-CXCL4 / PF4 Reference Antibody (U.Penn. patent anti-PF4)synonym : null,productDescription :...
Anti-SERPINE1 Reference Antibody (Sanofi patent anti-PAI-1)
Product Name : Anti-SERPINE1 Reference Antibody (Sanofi patent anti-PAI-1)synonym : null,productDescription : Anti-SERPINE1 Reference...
Anti-Orai1 Reference Antibody (Amgen patent anti-ORAI1)
Product Name : Anti-Orai1 Reference Antibody (Amgen patent anti-ORAI1)synonym : null,productDescription : Anti-Orai1 Reference...
Anti-KLK5 / Kallikrein 5 Reference Antibody (Genentech patent anti-KLK5)
Product Name : Anti-KLK5 / Kallikrein 5 Reference Antibody (Genentech patent anti-KLK5)synonym : null,productDescription...
Anti-HGFA Reference Antibody (Genentech patent anti-HGFA\t)
Product Name : Anti-HGFA Reference Antibody (Genentech patent anti-HGFA\t)synonym : null,productDescription : Anti-HGFA Reference...
Anti-TMPRSS2 Reference Antibody (Regeneron patent anti-TMPRSS2 \t)
Product Name : Anti-TMPRSS2 Reference Antibody (Regeneron patent anti-TMPRSS2 \t)synonym : null,productDescription : Anti-TMPRSS2...
Anti-TAT226 Reference Antibody (Genentech patent anti-TAT226)
Product Name : Anti-TAT226 Reference Antibody (Genentech patent anti-TAT226)synonym : null,productDescription : Anti-TAT226 Reference...
Anti-RGMC / HFE2 Reference Antibody (DISC-0974)
Product Name : Anti-RGMC / HFE2 Reference Antibody (DISC-0974)synonym : null,productDescription : Anti-RGMC /...
Anti-Complement Factor P / Properdin Reference Antibody (Novelmed patent anti-Properdin)
Product Name : Anti-Complement Factor P / Properdin Reference Antibody (Novelmed patent anti-Properdin)synonym :...
Anti-PACAP38 Reference Antibody (Lilly patent anti-PACAP)
Product Name : Anti-PACAP38 Reference Antibody (Lilly patent anti-PACAP)synonym : null,productDescription : Anti-PACAP38 Reference...
Anti-CDX-2 Rabbit mAb
Product Name : Anti-CDX-2 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 34endotoxin : Nonepurity...
Anti-Nogo Receptor / NgR Reference Antibody (Abbott patent anti-NGR)
Product Name : Anti-Nogo Receptor / NgR Reference Antibody (Abbott patent anti-NGR)synonym : null,productDescription...
Anti-Integrin b2 / ITGB2 / CD18 Reference Antibody (erlizumab)
Product Name : Anti-Integrin b2 / ITGB2 / CD18 Reference Antibody (erlizumab)synonym : null,productDescription...
Anti-GREM1 / Gremlin Reference Antibody (Regeneron patent anti-GREM1)
Product Name : Anti-GREM1 / Gremlin Reference Antibody (Regeneron patent anti-GREM1)synonym : null,productDescription :...
Anti-GOLM1 Reference Antibody (Cureab patent anti-GP73)
Product Name : Anti-GOLM1 Reference Antibody (Cureab patent anti-GP73)synonym : null,productDescription : Anti-GOLM1 Reference...
Anti-GPR44 / PTGDR2 / CD294 Reference Antibody (KHK patent anti-CRTH2)
Product Name : Anti-GPR44 / PTGDR2 / CD294 Reference Antibody (KHK patent anti-CRTH2)synonym :...
Anti-TPSAB1 Reference Antibody (Genentech patent anti-Tryptase Beta 1)
Product Name : Anti-TPSAB1 Reference Antibody (Genentech patent anti-Tryptase Beta 1)synonym : null,productDescription :...
Anti-MPL / TPOR / CD110 Reference Antibody (TA136)
Product Name : Anti-MPL / TPOR / CD110 Reference Antibody (TA136)synonym : null,productDescription :...
Anti-CXCR3 / GPR9 / CD183 Reference Antibody (Genzyme patent anti-CXCR3)
Product Name : Anti-CXCR3 / GPR9 / CD183 Reference Antibody (Genzyme patent anti-CXCR3)synonym :...
Anti-vWF Reference Antibody (INSERM patent anti-vWF)
Product Name : Anti-vWF Reference Antibody (INSERM patent anti-vWF)synonym : null,productDescription : Anti-vWF Reference...
Anti-Sialyl-Lewis A Reference Antibody (MVT-5873)
Product Name : Anti-Sialyl-Lewis A Reference Antibody (MVT-5873)synonym : null,productDescription : Anti-Sialyl-Lewis A Reference...
Anti-CD163 Rabbit mAb
Product Name : Anti-CD163 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 125endotoxin : Nonepurity...
Anti-F9 / Factor IX Reference Antibody (emicizumab)
Product Name : Anti-F9 / Factor IX Reference Antibody (emicizumab)synonym : null,productDescription : Anti-F9...
Anti-PTPRC / CD45 Reference Antibody (apamistamab)
Product Name : Anti-PTPRC / CD45 Reference Antibody (apamistamab)synonym : null,productDescription : Anti-PTPRC /...
Anti-NaPi2b / SLC34A2 Reference Antibody (Lifastuzumab)
Product Name : Anti-NaPi2b / SLC34A2 Reference Antibody (Lifastuzumab)synonym : null,productDescription : Anti-SLC34A2 Reference...
Anti-CD74 Reference Antibody (milatuzumab)
Product Name : Anti-CD74 Reference Antibody (milatuzumab)synonym : null,productDescription : Anti-CD74 Reference Antibody (milatuzumab)(CHA421)...
Anti-Integrin aVb6 (ITGAV & ITGB6) Reference Antibody (STX-100)
Product Name : Anti-Integrin aVb6 (ITGAV & ITGB6) Reference Antibody (STX-100)synonym : null,productDescription :...
Anti-GUCY2C Reference Antibody (indusatumab)
Product Name : Anti-GUCY2C Reference Antibody (indusatumab)synonym : null,productDescription : Anti-GUCY2C Reference Antibody (indusatumab)(CHA418)...
Anti-ILDR2 Reference Antibody (bapotulimab)
Product Name : Anti-ILDR2 Reference Antibody (bapotulimab)synonym : null,productDescription : Anti-ILDR2 Reference Antibody (bapotulimab)(CHA414)...
Anti-IL-13Ra1 / CD213a1 Reference Antibody (MK-6105)
Product Name : Anti-IL-13Ra1 / CD213a1 Reference Antibody (MK-6105)synonym : null,productDescription : Anti-IL-13Ra1 /...
Anti-Phosphorylcholine Reference Antibody (ATH3G10)
Product Name : Anti-Phosphorylcholine Reference Antibody (ATH3G10)synonym : null,productDescription : Anti-Phosphorylcholine Reference Antibody (ATH3G10)(CHA411)...
Anti-GP6 / Glycoprotein-6 Reference Antibody (glenzocimab)
Product Name : Anti-GP6 / Glycoprotein-6 Reference Antibody (glenzocimab)synonym : null,productDescription : Anti-GP6 /...
Anti-Syndecan-1 / CD138 Rabbit mAb
Product Name : Anti-Syndecan-1 / CD138 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 32endotoxin...
Anti-GFRAL Reference Antibody (NGM120)
Product Name : Anti-GFRAL Reference Antibody (NGM120)synonym : null,productDescription : Anti-GFRAL Reference Antibody (NGM120)(CHA405)...
Anti-CSF2Rb / CD131 Reference Antibody (CSL311)
Product Name : Anti-CSF2Rb / CD131 Reference Antibody (CSL311)synonym : null,productDescription : Anti-CSF2Rb /...
Anti-C1q Reference Antibody (ANX005)
Product Name : Anti-C1q Reference Antibody (ANX005)synonym : productDescription : Anti-C1q Reference Antibody (ANX005)(CHA403)...
Anti-Adrenomedullin Reference Antibody (enibarcimab)
Product Name : Anti-Adrenomedullin Reference Antibody (enibarcimab)synonym : null,productDescription : Anti-Adrenomedullin Reference Antibody (enibarcimab)(CHA402)...
Anti-INHBA / Activin A Reference Antibody (garetosmab)
Product Name : Anti-INHBA / Activin A Reference Antibody (garetosmab)synonym : null,productDescription : Anti-INHBA...
Anti-VEGFB Reference Antibody (CSL346)
Product Name : Anti-VEGFB Reference Antibody (CSL346)synonym : null,productDescription : Anti-VEGFB Reference Antibody (CSL346)(CHA400)...
Anti-Integrin b1 / ITGB1 / CD29 Reference Antibody (OS2966)
Product Name : Anti-Integrin b1 / ITGB1 / CD29 Reference Antibody (OS2966)synonym : null,productDescription...
Anti-GPR20 Reference Antibody (DS-6157)
Product Name : Anti-GPR20 Reference Antibody (DS-6157)synonym : null,productDescription : Anti-GPR20 Reference Antibody (DS-6157)(CHA395)...
Anti-CSF3 / G-CSF Reference Antibody (CSL324)
Product Name : Anti-CSF3 / G-CSF Reference Antibody (CSL324)synonym : null,productDescription : Anti-CSF3R /...
Anti-Clusterin Reference Antibody (AB-16B5)
Product Name : Anti-Clusterin Reference Antibody (AB-16B5)synonym : null,productDescription : Anti-Clusterin Reference Antibody (AB-16B5)(CHA392)...
Anti-IL-3Ra / CD123 Mouse mAb
Product Name : Anti-IL-3Ra / CD123 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 43endotoxin...
Anti-CD14 Reference Antibody (atibuclimab)
Product Name : Anti-CD14 Reference Antibody (atibuclimab)synonym : null,productDescription : Anti-CD14 Reference Antibody (atibuclimab)(CHA391)...
Anti-Complement C3 Reference Antibody (NGM621)
Product Name : Anti-Complement C3 Reference Antibody (NGM621)synonym : null,productDescription : Anti-Complement C3 Reference...
Anti-Complement C2 Reference Antibody (ARGX-117)
Product Name : Anti-Complement C2 Reference Antibody (ARGX-117)synonym : null,productDescription : Anti-Complement C2 Reference...
Anti-BTN1A1 Reference Antibody (CTX-2026)
Product Name : Anti-BTN1A1 Reference Antibody (CTX-2026)synonym : null,productDescription : Anti-BTN1A1 Reference Antibody (CTX-2026)(CHA388)...
Anti-IL-22Ra Reference Antibody (ARGX-112)
Product Name : Anti-IL-22Ra Reference Antibody (ARGX-112)synonym : null,productDescription : Anti-IL-22Ra Reference Antibody (ARGX-112)(CHA384)...
Anti-IFNAR1 Reference Antibody (anifrolumab)
Product Name : Anti-IFNAR1 Reference Antibody (anifrolumab)synonym : null,productDescription : Anti-IFNAR1 Reference Antibody (anifrolumab)(CHA383)...
Anti-Fucosyl GM1 Reference Antibody (BMS-986012)
Product Name : Anti-Fucosyl GM1 Reference Antibody (BMS-986012)synonym : null,productDescription : Anti-Fucosyl GM1 Reference...
Anti-FGF23 Reference Antibody (burosumab)
Product Name : Anti-FGF23 Reference Antibody (burosumab)synonym : null,productDescription : Anti-FGF23 Reference Antibody (burosumab)(CHA381)...
Anti-F12 / Factor XII Reference Antibody (garadacimab)
Product Name : Anti-F12 / Factor XII Reference Antibody (garadacimab)synonym : null,productDescription : Anti-F12...
Anti-CALCRL / CGRPR Reference Antibody (erenumab)
Product Name : Anti-CALCRL / CGRPR Reference Antibody (erenumab)synonym : null,productDescription : Anti-CALCRL /...
Anti-Endoglin / CD105 Rabbit mAb
Product Name : Anti-Endoglin / CD105 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 71endotoxin...
Anti-CB1 / CNR1 Reference Antibody (GFB-024)
Product Name : Anti-CB1 / CNR1 Reference Antibody (GFB-024)synonym : null,productDescription : Anti-CB1 /...
Anti-TNFRSF13C / BAFFR / CD268 Reference Antibody (ianalumab)
Product Name : Anti-TNFRSF13C / BAFFR / CD268 Reference Antibody (ianalumab)synonym : null,productDescription :...
Anti-Melanotransferrin / CD228 Reference Antibody (SC-005)
Product Name : Anti-Melanotransferrin / CD228 Reference Antibody (SC-005)synonym : null,productDescription : Anti-Melanotransferrin /...
Anti-CD48 Reference Antibody (Regeneron patent anti-CD48)
Product Name : Anti-CD48 Reference Antibody (Regeneron patent anti-CD48)synonym : null,productDescription : Anti-CD48 Reference...
Anti-Endoglin / CD105 Reference Antibody (carotuximab)
Product Name : Anti-Endoglin / CD105 Reference Antibody (carotuximab)synonym : null,productDescription : Anti-Endoglin /...
Anti-SLC1A5 / ASCT2 Reference Antibody (idactamab)
Product Name : Anti-SLC1A5 / ASCT2 Reference Antibody (idactamab)synonym : null,productDescription : Anti-SLC1A5 /...
Anti-AMHR2 Reference Antibody (murlentamab)
Product Name : Anti-AMHR2 Reference Antibody (murlentamab)synonym : null,productDescription : Anti-AMHR2 Reference Antibody (murlentamab)(CHA371)...
Anti-ROBO1 Reference Antibody (Asclepius Technology patent anti-Robo1 CAR)
Product Name : Anti-ROBO1 Reference Antibody (Asclepius Technology patent anti-Robo1 CAR)synonym : null,productDescription :...
Anti-CD6 Reference Antibody (itolizumab)
Product Name : Anti-CD6 Reference Antibody (itolizumab)synonym : null,productDescription : Anti-CD6 Reference Antibody (itolizumab)(CHA368)...
Anti-FZD10 Reference Antibody (tabituximab)
Product Name : Anti-FZD10 Reference Antibody (tabituximab)synonym : null,productDescription : Anti-FZD10 Reference Antibody (tabituximab)(CHA366)...
Anti-CD99 Mouse mAb
Product Name : Anti-CD99 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 19endotoxin : Nonepurity...
Anti-ACTH Mouse mAb
Product Name : Anti-ACTH Mouse mAbsynonym : productDescription : NonemolecularWeight : 29 kDaendotoxin :...
Anti-CDH6 / K-Cadherin Reference Antibody (DS-6000a)
Product Name : Anti-CDH6 / K-Cadherin Reference Antibody (DS-6000a)synonym : null,productDescription : Anti-CDH6 /...
Anti-VEGFR1 / FLT1 Reference Antibody (icrucumab)
Product Name : Anti-VEGFR1 / FLT1 Reference Antibody (icrucumab)synonym : null,productDescription : Anti-VEGFR1 /...
Anti-AOC3 / VAP1 Reference Antibody (timolumab)
Product Name : Anti-AOC3 / VAP1 Reference Antibody (timolumab)synonym : null,productDescription : Anti-AOC3 /...
Anti-TYRO3 Reference Antibody (ELB031)
Product Name : Anti-TYRO3 Reference Antibody (ELB031)synonym : null,productDescription : Anti-TYRO3 Reference Antibody (ELB031)(CHA357)...
Anti-TNFRSF12A / TWEAKR / CD266 Reference Antibody (enavatuzumab)
Product Name : Anti-TNFRSF12A / TWEAKR / CD266 Reference Antibody (enavatuzumab)synonym : null,productDescription :...
Anti-TROP2 Reference Antibody (sacituzumab)
Product Name : Anti-TROP2 Reference Antibody (sacituzumab)synonym : null,productDescription : Anti-TROP2 Reference Antibody (sacituzumab)(CHA355)...
Anti-TrkA / NTRK1 Reference Antibody (GBR 900)
Product Name : Anti-TrkA / NTRK1 Reference Antibody (GBR 900)synonym : null,productDescription : Anti-TrkA...
Anti-TNFRSF10A / TRAILR1 / CD261 Reference Antibody ( mapatumumab)
Product Name : Anti-TNFRSF10A / TRAILR1 / CD261 Reference Antibody ( mapatumumab)synonym : null,productDescription...
Anti-TLR2 / CD282 Reference Antibody (tomaralimab)
Product Name : Anti-TLR2 / CD282 Reference Antibody (tomaralimab)synonym : null,productDescription : Anti-TLR2 /...
Anti-TIM-3 / HAVCR2 / CD366 Reference Antibody (sabatolimab)
Product Name : Anti-TIM-3 / HAVCR2 / CD366 Reference Antibody (sabatolimab)synonym : null,productDescription :...
Anti-CD79a Rabbit mAb
Product Name : Anti-CD79a Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 25endotoxin : Nonepurity...
Anti-TGFb1 Reference Antibody (M7824)
Product Name : Anti-TGFb1 Reference Antibody (M7824)synonym : null,productDescription : Anti-TGFb1 Reference Antibody (M7824)(CHA348)...
Anti-TGFb1 Reference Antibody (SRK181)
Product Name : Anti-TGFb1 Reference Antibody (SRK181)synonym : null,productDescription : Anti-TGFb1 Reference Antibody (SRK181)(CHA347)...
Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (tisotumab)
Product Name : Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody...
Anti-Tau Reference Antibody (semorinemab)
Product Name : Anti-Tau Reference Antibody (semorinemab)synonym : null,productDescription : Anti-Tau Reference Antibody (semorinemab)(CHA345)...
Anti-Tau Reference Antibody (gosuranemab)
Product Name : Anti-Tau Reference Antibody (gosuranemab)synonym : null,productDescription : Anti-Tau Reference Antibody (gosuranemab)(CHA344)...
Anti-Syndecan-1 / CD138 Reference Antibody (indatuximab)
Product Name : Anti-Syndecan-1 / CD138 Reference Antibody (indatuximab)synonym : null,productDescription : Anti-Syndecan-1 /...
Anti-STAB1 Reference Antibody (bexmarilimab)
Product Name : Anti-STAB1 Reference Antibody (bexmarilimab)synonym : null,productDescription : Anti-STAB1 Reference Antibody (bexmarilimab)(CHA341)...
Anti-SIRPg / CD172g Reference Antibody (KWAR23)
Product Name : Anti-SIRPg / CD172g Reference Antibody (KWAR23)synonym : productDescription : Anti-SIRPg /...
Anti-SIRPa / CD172a Reference Antibody (Hospital for Sick Children patent anti-SIRPA)
Product Name : Anti-SIRPa / CD172a Reference Antibody (Hospital for Sick Children patent anti-SIRPA)synonym...
Anti-SEMA4D / CD100 Reference Antibody (pepinemab)
Product Name : Anti-SEMA4D / CD100 Reference Antibody (pepinemab)synonym : null,productDescription : Anti-SEMA4D /...
Anti-CD74 Rabbit mAb
Product Name : Anti-CD74 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 34endotoxin : Nonepurity...
Anti-SOST / Sclerostin Reference Antibody (romosozumab)
Product Name : Anti-SOST / Sclerostin Reference Antibody (romosozumab)synonym : null,productDescription : Anti-SOST /...
Anti-SOST / Sclerostin Reference Antibody (setrusumab)
Product Name : Anti-SOST / Sclerostin Reference Antibody (setrusumab)synonym : null,productDescription : Anti-SOST /...
Anti-RSPO3 Reference Antibody (rosmantuzumab)
Product Name : Anti-RSPO3 Reference Antibody (rosmantuzumab)synonym : null,productDescription : Anti-RSPO3 Reference Antibody (rosmantuzumab)(CHA333)...
Anti-RSPO1 Reference Antibody (Oncomed patent anti-RSPO1)
Product Name : Anti-RSPO1 Reference Antibody (Oncomed patent anti-RSPO1)synonym : null,productDescription : Anti-RSPO1 Reference...
Anti-MSPR / RON / CD136 Reference Antibody (narnatumab)
Product Name : Anti-MSPR / RON / CD136 Reference Antibody (narnatumab)synonym : null,productDescription :...
Anti-TNFSF11 / RANKL / CD254 Reference Antibody (denosumab)
Product Name : Anti-TNFSF11 / RANKL / CD254 Reference Antibody (denosumab)synonym : null,productDescription :...
Anti-AGER / RAGE Reference Antibody (XT-M4)
Product Name : Anti-AGER / RAGE Reference Antibody (XT-M4)synonym : null,productDescription : Anti-AGER /...
Anti-PVRIG Reference Antibody (COM701)
Product Name : Anti-PVRIG Reference Antibody (COM701)synonym : null,productDescription : Anti-PVRIG Reference Antibody (COM701)(CHA328)...
Anti-PVRIG Reference Antibody (GSK4381562)
Product Name : Anti-PVRIG Reference Antibody (GSK4381562)synonym : null,productDescription : Anti-PVRIG Reference Antibody (GSK4381562)(CHA327)...
Anti-PSCA Reference Antibody (AGS-1C4D4)
Product Name : Anti-PSCA Reference Antibody (AGS-1C4D4)synonym : null,productDescription : Anti-PSCA Reference Antibody (AGS-1C4D4)(CHA326)...
Anti-Transferrin receptor / CD71 Rabbit mAb
Product Name : Anti-Transferrin receptor / CD71 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight :...
Anti-PRAME Reference Antibody (Eureka patent anti-PRAME)
Product Name : Anti-PRAME Reference Antibody (Eureka patent anti-PRAME)synonym : null,productDescription : Anti-PRAME Reference...
Anti-PLA2G1B Reference Antibody (Diaccurate patent anti-sPLA2-GIB)
Product Name : Anti-PLA2G1B Reference Antibody (Diaccurate patent anti-sPLA2-GIB)synonym : null,productDescription : Anti-PLA2G1B Reference...
Anti-PGLYRP1 / PGRP-S Reference Antibody (Novo Nordisk patent anti-PGLYRP1)
Product Name : Anti-PGLYRP1 / PGRP-S Reference Antibody (Novo Nordisk patent anti-PGLYRP1)synonym : null,productDescription...
Anti-PDGFRB / CD140b Reference Antibody (rinucumab)
Product Name : Anti-PDGFRB / CD140b Reference Antibody (rinucumab)synonym : null,productDescription : Anti-PDGFRB /...
Anti-PDGFRA / CD140a Reference Antibody (olaratumab)
Product Name : Anti-PDGFRA / CD140a Reference Antibody (olaratumab)synonym : null,productDescription : Anti-PDGFRA /...
Anti-PDGFRA / CD140a Reference Antibody (tovetumab)
Product Name : Anti-PDGFRA / CD140a Reference Antibody (tovetumab)synonym : null,productDescription : Anti-PDGFRA /...
Anti-PDGFC / VEGFE Reference Antibody (Thrombogenics patent anti-PDGF-C)
Product Name : Anti-PDGFC / VEGFE Reference Antibody (Thrombogenics patent anti-PDGF-C)synonym : null,productDescription :...
Anti-PCSK9 Reference Antibody (alirocumab)
Product Name : Anti-PCSK9 Reference Antibody (alirocumab)synonym : null,productDescription : Anti-PCSK9 Reference Antibody (alirocumab)(CHA316)...
Anti-TNFSF4 / OX40L / CD252 Reference Antibody (oxelumab)
Product Name : Anti-TNFSF4 / OX40L / CD252 Reference Antibody (oxelumab)synonym : null,productDescription :...
Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (tavolixizumab)
Product Name : Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (tavolixizumab)synonym : null,productDescription :...
Anti-CD68 Rabbit mAb
Product Name : Anti-CD68 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 37endotoxin : Nonepurity...
Anti-NRP1 / VEGF165R / CD304 Reference Antibody (vesencumab)
Product Name : Anti-NRP1 / VEGF165R / CD304 Reference Antibody (vesencumab)synonym : null,productDescription :...
Anti-NOTCH1 Reference Antibody (brontictuzumab)
Product Name : Anti-NOTCH1 Reference Antibody (brontictuzumab)synonym : null,productDescription : Anti-NOTCH1 Reference Antibody (brontictuzumab)(CHA312)...
Anti-RTN4 / NOGO Reference Antibody (ozanezumab)
Product Name : Anti-RTN4 / NOGO Reference Antibody (ozanezumab)synonym : null,productDescription : Anti-RTN4 /...
Anti-NKG2A / CD94 Reference Antibody (monalizumab)
Product Name : Anti-NKG2A / CD94 Reference Antibody (monalizumab)synonym : null,productDescription : Anti-NKG2A /...
Anti-NGF / bNGF Reference Antibody (tanezumab)
Product Name : Anti-NGF / bNGF Reference Antibody (tanezumab)synonym : null,productDescription : Anti-NGF /...
Anti-NGF / bNGF Reference Antibody (fulranumab)
Product Name : Anti-NGF / bNGF Reference Antibody (fulranumab)synonym : null,productDescription : Anti-NGF /...
Anti-GDF8 / Myostatin Reference Antibody (trevogrumab)
Product Name : Anti-GDF8 / Myostatin Reference Antibody (trevogrumab)synonym : null,productDescription : Anti-GDF8 /...
Anti-GDF8 / Myostatin Reference Antibody (landogrozumab)
Product Name : Anti-GDF8 / Myostatin Reference Antibody (landogrozumab)synonym : null,productDescription : Anti-GDF8 /...
Anti-MUC16 Reference Antibody (sofituzumab)
Product Name : Anti-MUC16 Reference Antibody (sofituzumab)synonym : null,productDescription : Anti-MUC16 Reference Antibody (sofituzumab)(CHA305)...
Anti-MUC16 Reference Antibody (oregovomab)
Product Name : Anti-MUC16 Reference Antibody (oregovomab)synonym : null,productDescription : Anti-MUC16 Reference Antibody (oregovomab)(CHA304)...
Anti-CD63 Rabbit mAb
Product Name : Anti-CD63 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 26endotoxin : Nonepurity...
Anti-MUC1 Reference Antibody (clivatuzumab)
Product Name : Anti-MUC1 Reference Antibody (clivatuzumab)synonym : null,productDescription : Anti-MUC1 Reference Antibody (clivatuzumab)(CHA303)...
Anti-MU5AC Reference Antibody (ensituximab)
Product Name : Anti-MU5AC Reference Antibody (ensituximab)synonym : null,productDescription : Anti-MUC5AC Reference Antibody (ensituximab)(CHA302)...
Anti-MMP9 Reference Antibody (andecaliximab)
Product Name : Anti-MMP9 Reference Antibody (andecaliximab)synonym : null,productDescription : Anti-MMP9 Reference Antibody (andecaliximab)(CHA301)...
Anti-MIF Reference Antibody (imalumab)
Product Name : Anti-MIF Reference Antibody (imalumab)synonym : null,productDescription : Anti-MIF Reference Antibody (imalumab)(CHA300)...
Anti-Mesothelin Reference Antibody (anetumab)
Product Name : Anti-Mesothelin Reference Antibody (anetumab)synonym : null,productDescription : Anti-Mesothelin Reference Antibody (anetumab)(CHA299)...
Anti-Mesothelin Reference Antibody (amatuximab)
Product Name : Anti-Mesothelin Reference Antibody (amatuximab)synonym : null,productDescription : Anti-Mesothelin Reference Antibody (amatuximab)(CHA298)...
Anti-MER / MERTK Reference Antibody (RGX-019)
Product Name : Anti-MER / MERTK Reference Antibody (RGX-019)synonym : null,productDescription : Anti-MER /...
Anti-MASP2 Reference Antibody (narsoplimab)
Product Name : Anti-MASP2 Reference Antibody (narsoplimab)synonym : null,productDescription : Anti-MASP2 Reference Antibody (narsoplimab)(CHA296)...
Anti-MAGEA3 Reference Antibody (CT Atlantic patent anti-MAGE-A3)
Product Name : Anti-MAGEA3 Reference Antibody (CT Atlantic patent anti-MAGE-A3)synonym : null,productDescription : Anti-MAGEA3...
Anti-Siglec-4a / MAG Reference Antibody (refanezumab)
Product Name : Anti-Siglec-4a / MAG Reference Antibody (refanezumab)synonym : null,productDescription : Anti-Siglec-4a /...
Anti-CD61 Rabbit mAb
Product Name : Anti-CD61 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 87endotoxin : Nonepurity...
Anti-MADCAM1 Reference Antibody (ontamalimab)
Product Name : Anti-MADCAM1 Reference Antibody (ontamalimab)synonym : null,productDescription : Anti-MADCAM1 Reference Antibody (ontamalimab)(CHA292)...
Anti-LOXL2 Reference Antibody (simtuzumab)
Product Name : Anti-LOXL2 Reference Antibody (simtuzumab)synonym : null,productDescription : Anti-LOXL2 Reference Antibody (simtuzumab)(CHA290)...
Anti-LILRB2 / ILT4 / CD85d Reference Antibody (JTX-8064)
Product Name : Anti-LILRB2 / ILT4 / CD85d Reference Antibody (JTX-8064)synonym : null,productDescription :...
Anti-Lewis Y Reference Antibody (MB 311)
Product Name : Anti-Lewis Y Reference Antibody (MB 311)synonym : null,productDescription : Anti-Lewis Y...
Anti-LEPR / CD295 Reference Antibody (mibavademab)
Product Name : Anti-LEPR / CD295 Reference Antibody (mibavademab)synonym : null,productDescription : Anti-LEPR /...
Anti-LAP Reference Antibody (Brigham and Womens anti-LAP)
Product Name : Anti-LAP Reference Antibody (Brigham and Womens anti-LAP)synonym : null,productDescription : Anti-LAP...
Anti-LAG3 / CD223 Reference Antibody (relatlimab)
Product Name : Anti-LAG3 / CD223 Reference Antibody (relatlimab)synonym : null,productDescription : Anti-LAG3 /...
Anti-KIR2DL1 / CD158a Reference Antibody (Innate patent anti-KIR2DL)
Product Name : Anti-KIR2DL1 / CD158a Reference Antibody (Innate patent anti-KIR2DL)synonym : null,productDescription :...
Anti-IL-9 Reference Antibody (enokizumab)
Product Name : Anti-IL-9 Reference Antibody (enokizumab)synonym : null,productDescription : Anti-IL-9 Reference Antibody (enokizumab)(CHA282)...
Anti-CXCL8 / IL-8 Reference Antibody (HuMax-IL8)
Product Name : Anti-CXCL8 / IL-8 Reference Antibody (HuMax-IL8)synonym : null,productDescription : Anti-CXCL8 /...
Anti-CD57 Mouse mAb
Product Name : Anti-CD57 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 38endotoxin : Nonepurity...
Anti-IL-7Ra / CD127 Reference Antibody (lusvertikimab)
Product Name : Anti-IL-7Ra / CD127 Reference Antibody (lusvertikimab)synonym : null,productDescription : Anti-IL-7Ra /...
Anti-IL-5Ra/ CD125 Reference Antibody (benralizumab)
Product Name : Anti-IL-5Ra/ CD125 Reference Antibody (benralizumab)synonym : null,productDescription : Anti-IL-5Ra/ CD125 Reference...
Anti-IL-5 Reference Antibody (mepolizumab)
Product Name : Anti-IL-5 Reference Antibody (mepolizumab)synonym : null,productDescription : Anti-IL-5 Reference Antibody (mepolizumab)(CHA277)...
Anti-IL-4Ra / CD124 Reference Antibody (dupilumab)
Product Name : Anti-IL-4Ra / CD124 Reference Antibody (dupilumab)synonym : null,productDescription : Anti-IL-4Ra /...
Anti-IL-4 Reference Antibody (pascolizumab)
Product Name : Anti-IL-4 Reference Antibody (pascolizumab)synonym : null,productDescription : Anti-IL-4 Reference Antibody (pascolizumab)(CHA275)...
Anti-IL-33 Reference Antibody (etokimab)
Product Name : Anti-IL-33 Reference Antibody (etokimab)synonym : null,productDescription : Anti-IL-33 Reference Antibody (etokimab)(CHA274)...
Anti-IL-31Ra Reference Antibody (nemolizumab)
Product Name : Anti-IL-31Ra Reference Antibody (nemolizumab)synonym : null,productDescription : Anti-IL-31Ra Reference Antibody (nemolizumab)(CHA273)...
Anti-IL-2Ra / CD25 Reference Antibody (daclizumab)
Product Name : Anti-IL-2Ra / CD25 Reference Antibody (daclizumab)synonym : null,productDescription : Anti-IL-2Ra /...
Anti-IL-2Rb / CD122 Reference Antibody (Singapore ASTR patent anti-IL-2R beta / IL-2R gamma\t)
Product Name : Anti-IL-2Rb / CD122 Reference Antibody (Singapore ASTR patent anti-IL-2R beta /...
Anti-IL-23a Reference Antibody (tildrakizumab)
Product Name : Anti-IL-23a Reference Antibody (tildrakizumab)synonym : null,productDescription : Anti-IL-23a Reference Antibody (tildrakizumab)(CHA270)...
Anti-NCAM1 / CD56 Mouse mAb
Product Name : Anti-NCAM1 / CD56 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 95endotoxin...
Anti-IL-23 Reference Antibody (guselkumab)
Product Name : Anti-IL-23 Reference Antibody (guselkumab)synonym : null,productDescription : Anti-IL-23 Reference Antibody (guselkumab)(CHA269)...
Anti-IL-22 Reference Antibody (fezakinumab)
Product Name : Anti-IL-22 Reference Antibody (fezakinumab)synonym : null,productDescription : Anti-IL-22 Reference Antibody (fezakinumab)(CHA268)...
Anti-IL-20Ra Reference Antibody (Cheng Kung U. patent anti-IL-20R1)
Product Name : Anti-IL-20Ra Reference Antibody (Cheng Kung U. patent anti-IL-20R1)synonym : null,productDescription :...
Anti-IL-20 Reference Antibody (fletikumab)
Product Name : Anti-IL-20 Reference Antibody (fletikumab)synonym : null,productDescription : Anti-IL-20 Reference Antibody (fletikumab)(CHA266)...
Anti-IL-1RL2 / IL-36R Reference Antibody (imsidolimab)
Product Name : Anti-IL-1RL2 / IL-36R Reference Antibody (imsidolimab)synonym : null,productDescription : Anti-IL-1RL2 /...
Anti-IL-1RL2 / IL-36R Reference Antibody (spesolimab)
Product Name : Anti-IL-1RL2 / IL-36R Reference Antibody (spesolimab)synonym : null,productDescription : Anti-IL-1RL2 /...
Anti-IL-1R1 / CD121a Reference Antibody (AMG 108)
Product Name : Anti-IL-1R1 / CD121a Reference Antibody (AMG 108)synonym : null,productDescription : Anti-IL-1R1...
Anti-IL-17c Reference Antibody (MOR106)
Product Name : Anti-IL-17c Reference Antibody (MOR106)synonym : null,productDescription : Anti-IL-17c Reference Antibody (MOR106)(CHA261)...
Anti-IL-13Ra2 / CD213a2 Reference Antibody (Wake Forest U. patent anti-IL-13RA2)
Product Name : Anti-IL-13Ra2 / CD213a2 Reference Antibody (Wake Forest U. patent anti-IL-13RA2)synonym :...
Anti-IL-13 Reference Antibody (anrukinzumab)
Product Name : Anti-IL-13 Reference Antibody (anrukinzumab)synonym : null,productDescription : Anti-IL-13 Reference Antibody (anrukinzumab)(CHA259)...
Anti-CD45RO Mouse mAb
Product Name : Anti-CD45RO Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 147endotoxin : Nonepurity...
Anti-IGF1R / CD221 Reference Antibody (teprotumumab)
Product Name : Anti-IGF1R / CD221 Reference Antibody (teprotumumab)synonym : null,productDescription : Anti-IGF1R /...
Anti-IGF-1 Reference Antibody (xentuzumab)
Product Name : Anti-IGF-1 Reference Antibody (xentuzumab)synonym : null,productDescription : Anti-IGF1 Reference Antibody (xentuzumab)(CHA256)...
Anti-IFNa1 Reference Antibody (sifalimumab)
Product Name : Anti-IFNa1 Reference Antibody (sifalimumab)synonym : null,productDescription : Anti-IFNa1 Reference Antibody (sifalimumab)(CHA255)...
Anti-IFNa1 Reference Antibody (rontalizumab)
Product Name : Anti-IFNa1 Reference Antibody (rontalizumab)synonym : null,productDescription : Anti-IFNa1 Reference Antibody (rontalizumab)(CHA254)...
Anti-IDO2 Reference Antibody (LIMR patent anti-IDO2)
Product Name : Anti-IDO2 Reference Antibody (LIMR patent anti-IDO2)synonym : null,productDescription : Anti-IDO2 Reference...
Anti-ICOS / CD278 Reference Antibody (feladilimab)
Product Name : Anti-ICOS / CD278 Reference Antibody (feladilimab)synonym : null,productDescription : Anti-ICOS /...
Anti-ICOS / CD278 Reference Antibody (vopratelimab)
Product Name : Anti-ICOS / CD278 Reference Antibody (vopratelimab)synonym : null,productDescription : Anti-ICOS /...
Anti-HGFR / c-Met Reference Antibody (emibetuzumab)
Product Name : Anti-HGFR / c-Met Reference Antibody (emibetuzumab)synonym : null,productDescription : Anti-HGFR /...
Anti-HGF / SF Reference Antibody (rilotumumab)
Product Name : Anti-HGF / SF Reference Antibody (rilotumumab)synonym : null,productDescription : Anti-HGF /...
Anti-HGF / SF Reference Antibody (ficlatuzumab)
Product Name : Anti-HGF / SF Reference Antibody (ficlatuzumab)synonym : null,productDescription : Anti-HGF /...
Anti-CD45R Mouse mAb
Product Name : Anti-CD45R Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 147endotoxin : Nonepurity...
Anti-CD31 Mouse mAb
Product Name : Anti-CD31 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 83 kDaendotoxin :...
Anti-ERBB3 / HER3 Reference Antibody (seribantumab)
Product Name : Anti-ERBB3 / HER3 Reference Antibody (seribantumab)synonym : null,productDescription : Anti-ERBB3 /...
Anti-ERBB3 / HER3 Reference Antibody (patritumab)
Product Name : Anti-ERBB3 / HER3 Reference Antibody (patritumab)synonym : null,productDescription : Anti-ERBB3 /...
Anti-HBEGF Reference Antibody (U3-1565)
Product Name : Anti-HBEGF Reference Antibody (U3-1565)synonym : null,productDescription : Anti-HBEGF Reference Antibody (U3-1565)(CHA244)...
Anti-HBEGF Reference Antibody (KHK2866)
Product Name : Anti-HBEGF Reference Antibody (KHK2866)synonym : null,productDescription : Anti-HBEGF Reference Antibody (KHK2866)(CHA243)...
Anti-Haptoglobin Reference Antibody (KHK patent anti-Haptoglobin)
Product Name : Anti-Haptoglobin Reference Antibody (KHK patent anti-Haptoglobin)synonym : null,productDescription : Anti-Haptoglobin Reference...
Anti-GREM1 / Gremlin Reference Antibody (UCB patent anti-Gremlin-1)
Product Name : Anti-GREM1 / Gremlin Reference Antibody (UCB patent anti-Gremlin-1)synonym : null,productDescription :...
Anti-GPRC5D Reference Antibody (talquetamab)
Product Name : Anti-GPRC5D Reference Antibody (talquetamab)synonym : null,productDescription : Anti-GPRC5D Reference Antibody (talquetamab)(CHA238)...
Anti-GPR49 / LGR5 Reference Antibody (petosemtamab)
Product Name : Anti-GPR49 / LGR5 Reference Antibody (petosemtamab)synonym : null,productDescription : Anti-GPR49 /...
Anti-GPR49 / LGR5 Reference Antibody (BNC101)
Product Name : Anti-GPR49 / LGR5 Reference Antibody (BNC101)synonym : null,productDescription : Anti-GPR49 /...
Anti-GPNMB Reference Antibody (glembatumumab)
Product Name : Anti-GPNMB Reference Antibody (glembatumumab)synonym : null,productDescription : Anti-GPNMB Reference Antibody (glembatumumab)(CHA235)...
Anti-PTPRC / CD45Rabbit mAb
Product Name : Anti-PTPRC / CD45Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 147endotoxin :...
Anti-GPA33 Reference Antibody (KRN330)
Product Name : Anti-GPA33 Reference Antibody (KRN330)synonym : null,productDescription : Anti-GPA33 Reference Antibody (KRN330)(CHA234)...
Anti-CSF2Ra / GM-CSFRa / CD116 Reference Antibody (mavrilimumab)
Product Name : Anti-CSF2Ra / GM-CSFRa / CD116 Reference Antibody (mavrilimumab)synonym : null,productDescription :...
Anti-TNFRSF18 / GITR / CD357 Reference Antibody (ragifilimab)
Product Name : Anti-TNFRSF18 / GITR / CD357 Reference Antibody (ragifilimab)synonym : null,productDescription :...
Anti-GIPR Reference Antibody (Amgen patent anti-GIPR)
Product Name : Anti-GIPR Reference Antibody (Amgen patent anti-GIPR)synonym : null,productDescription : Anti-GIPR Reference...
Anti-CSF3R / G-CSFR Reference Antibody (CSL patent anti-G-CSFR)
Product Name : Anti-CSF3R / G-CSFR Reference Antibody (CSL patent anti-G-CSFR)synonym : null,productDescription :...
Anti-GCGR Reference Antibody (volagidemab)
Product Name : Anti-GCGR Reference Antibody (volagidemab)synonym : null,productDescription : Anti-GCGR Reference Antibody (volagidemab)(CHA227)...
Anti-GCGR Reference Antibody (crotedumab)
Product Name : Anti-GCGR Reference Antibody (crotedumab)synonym : null,productDescription : Anti-GCGR Reference Antibody (crotedumab)(CHA226)...
Anti-FZD7 Reference Antibody (U.Toronto patent anti-FZD7)
Product Name : Anti-FZD7 Reference Antibody (U.Toronto patent anti-FZD7)synonym : null,productDescription : Anti-FZD7 Reference...
Anti-FLT3 / CD135 Reference Antibody (IMC-EB10)
Product Name : Anti-FLT3 / CD135 Reference Antibody (IMC-EB10)synonym : null,productDescription : Anti-FLT3 /...
Anti-Fibronectin Reference Antibody (L19-TNF)
Product Name : Anti-Fibronectin Reference Antibody (L19-TNF)synonym : null,productDescription : Anti-Fibronectin Reference Antibody (L19-TNF)(CHA219)...
Anti-CD44 Mouse mAb
Product Name : Anti-CD44 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 82endotoxin : Nonepurity...
Anti-FGFR4 / CD334 Reference Antibody (U3-1784)
Product Name : Anti-FGFR4 / CD334 Reference Antibody (U3-1784)synonym : null,productDescription : Anti-FGFR4 /...
Anti-FGFR3 / CD333 Reference Antibody (vofatamab)
Product Name : Anti-FGFR3 / CD333 Reference Antibody (vofatamab)synonym : null,productDescription : Anti-FGFR3 /...
Anti-FGFR3 / CD333 Reference Antibody (LY3076226)
Product Name : Anti-FGFR3 / CD333 Reference Antibody (LY3076226)synonym : null,productDescription : Anti-FGFR3 /...
Anti-FGF2 Reference Antibody (HuGAL-F2)
Product Name : Anti-FGF2 Reference Antibody (HuGAL-F2)synonym : null,productDescription : Anti-FGF2 Reference Antibody (HuGAL-F2)(CHA215)...
Anti-FGF19 Reference Antibody (1A6)
Product Name : Anti-FGF19 Reference Antibody (1A6)synonym : null,productDescription : Anti-FGF19 Reference Antibody (1A6)(CHA214)...
Anti-SLC40A1 Reference Antibody (Amgen patent anti-Ferroportin)
Product Name : Anti-SLC40A1 Reference Antibody (Amgen patent anti-Ferroportin)synonym : null,productDescription : Anti-SLC40A1 Reference...
Anti-SLC40A1 Reference Antibody (LY2928057)
Product Name : Anti-SLC40A1 Reference Antibody (LY2928057)synonym : null,productDescription : Anti-SLC40A1 Reference Antibody (LY2928057)(CHA212)...
Anti-FAP Reference Antibody (sibrotuzumab)
Product Name : Anti-FAP Reference Antibody (sibrotuzumab)synonym : null,productDescription : Anti-FAP Reference Antibody (sibrotuzumab)(CHA211)...
Anti-EPOR Reference Antibody (Abbott patent anti-EPO Receptor)
Product Name : Anti-EPOR Reference Antibody (Abbott patent anti-EPO Receptor)synonym : null,productDescription : Anti-EPOR...
Anti-EphB4 Reference Antibody (VasGene patent anti-EphB4)
Product Name : Anti-EphB4 Reference Antibody (VasGene patent anti-EphB4)synonym : null,productDescription : Anti-EphB4 Reference...
Anti-CD43 Mouse mAb
Product Name : Anti-CD43 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 40endotoxin : Nonepurity...
Anti-EphB4 Reference Antibody (Morphosys patent anti-EphB4)
Product Name : Anti-EphB4 Reference Antibody (Morphosys patent anti-EphB4)synonym : null,productDescription : Anti-EphB4 Reference...
Anti-EphB2 Reference Antibody (Genentech patent anti-EphB2)
Product Name : Anti-EphB2 Reference Antibody (Genentech patent anti-EphB2)synonym : null,productDescription : Anti-EphB2 Reference...
Anti-EpCAM / TROP1 / CD326 Reference Antibody (citatuzumab)
Product Name : Anti-EpCAM / TROP1 / CD326 Reference Antibody (citatuzumab)synonym : null,productDescription :...
Anti-TNFRSF21 / DR6 / CD358 Reference Antibody (Abbvie patent anti-TNFRSF21)
Product Name : Anti-TNFRSF21 / DR6 / CD358 Reference Antibody (Abbvie patent anti-TNFRSF21)synonym :...
Anti-DLL4 Reference Antibody (navicixizumab)
Product Name : Anti-DLL4 Reference Antibody (navicixizumab)synonym : null,productDescription : Anti-DLL4 Reference Antibody (navicixizumab)(CHA199)...
Anti-DLL4 Reference Antibody (demcizumab)
Product Name : Anti-DLL4 Reference Antibody (demcizumab)synonym : null,productDescription : Anti-DLL4 Reference Antibody (demcizumab)(CHA198)...
Anti-DKK1 Reference Antibody (BHQ-880)
Product Name : Anti-DKK1 Reference Antibody (BHQ-880)synonym : null,productDescription : Anti-DKK1 Reference Antibody (BHQ-880)(CHA197)...
Anti-CLEC7A Reference Antibody (Baylor patent anti-Dectin-1)
Product Name : Anti-CLEC7A Reference Antibody (Baylor patent anti-Dectin-1)synonym : null,productDescription : Anti-CLEC7A Reference...
Anti-DC-SIGN / CD209 Reference Antibody (INSERM patent anti-DC-SIGN)
Product Name : Anti-DC-SIGN / CD209 Reference Antibody (INSERM patent anti-DC-SIGN)synonym : null,productDescription :...
Anti-CXCR5 / CD185 Reference Antibody (SAR113244)
Product Name : Anti-CXCR5 / CD185 Reference Antibody (SAR113244)synonym : null,productDescription : Anti-CXCR5 /...
Anti-CD38 Rabbit mAb
Product Name : Anti-CD38 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 34endotoxin : Nonepurity...
Anti-CXCL9 Reference Antibody (Novimmune patent anti-CXCL9)
Product Name : Anti-CXCL9 Reference Antibody (Novimmune patent anti-CXCL9)synonym : null,productDescription : Anti-CXCL9 Reference...
Anti-CXCL10 / IP-10 Reference Antibody (eldelumab)
Product Name : Anti-CXCL10 / IP-10 Reference Antibody (eldelumab)synonym : null,productDescription : Anti-CXCL10 /...
Anti-CXADR Reference Antibody (Med. Bio. Labs patent anti-CXADR)
Product Name : Anti-CXADR Reference Antibody (Med. Bio. Labs patent anti-CXADR)synonym : null,productDescription :...
Anti-CSF1R / M-CSFR / CD115 Reference Antibody (cabiralizumab)
Product Name : Anti-CSF1R / M-CSFR / CD115 Reference Antibody (cabiralizumab)synonym : null,productDescription :...
Anti-CRTAM / CD355 Reference Antibody (Oxford Bio patent anti-CRTAM)
Product Name : Anti-CRTAM / CD355 Reference Antibody (Oxford Bio patent anti-CRTAM)synonym : null,productDescription...
Anti-CLEC14A Reference Antibody (Scripps Korea patent anti-CLEC14A)
Product Name : Anti-CLEC14A Reference Antibody (Scripps Korea patent anti-CLEC14A)synonym : null,productDescription : Anti-CLEC14A...
Anti-CLEC12A / CD371 Reference Antibody (tepoditamab)
Product Name : Anti-CLEC12A / CD371 Reference Antibody (tepoditamab)synonym : null,productDescription : Anti-CLEC12A /...
Anti-CLDN6 Reference Antibody (IMAB027)
Product Name : Anti-CLDN6 Reference Antibody (IMAB027)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (IMAB027)(CHA182)...
Anti-CLDN18.2 Reference Antibody (zolbetuximab)
Product Name : Anti-CLDN18.2 Reference Antibody (zolbetuximab)synonym : null,productDescription : Anti-CLDN18.2 Reference Antibody (zolbetuximab)(CHA181)...
Anti-DCBLD2 / ESDN Reference Antibody (FA19-1)
Product Name : Anti-DCBLD2 / ESDN Reference Antibody (FA19-1)synonym : null,productDescription : Anti-DCBLD2 /...
Anti-CD35 Rabbit mAb
Product Name : Anti-CD35 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 224endotoxin : Nonepurity...
Anti-CCL20 Reference Antibody (GSK3050002)
Product Name : Anti-CCL20 Reference Antibody (GSK3050002)synonym : null,productDescription : Anti-CCL20 Reference Antibody (GSK3050002)(CHA179)...
Anti-CHI3L1 Reference Antibody (Brown U. patent anti-CHI3L1)
Product Name : Anti-CHI3L1 Reference Antibody (Brown U. patent anti-CHI3L1)synonym : null,productDescription : Anti-CHI3L1...
Anti-CEACAM6 / CD66c Reference Antibody (NEO-201)
Product Name : Anti-CEACAM6 / CD66c Reference Antibody (NEO-201)synonym : null,productDescription : Anti-CEACAM6 /...
Anti-CEACAM1 / CD66a Reference Antibody (CM-24)
Product Name : Anti-CEACAM1 / CD66a Reference Antibody (CM-24)synonym : null,productDescription : Anti-CEACAM1 /...
Anti-CEACAM5 / CEA / CD66e Reference Antibody (labetuzumab)
Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (labetuzumab)synonym : null,productDescription :...
Anti-CDCP1 / CD318 Reference Antibody (U.California patent anti-CDCP1)
Product Name : Anti-CDCP1 / CD318 Reference Antibody (U.California patent anti-CDCP1)synonym : null,productDescription :...
Anti-CD79b Reference Antibody (polatuzumab)
Product Name : Anti-CD79b Reference Antibody (polatuzumab)synonym : null,productDescription : Anti-CD79b Reference Antibody (polatuzumab)(CHA171)...
Anti-CD69 Reference Antibody (Genefrontier patent anti-CD69)
Product Name : Anti-CD69 Reference Antibody (Genefrontier patent anti-CD69)synonym : null,productDescription : Anti-CD69 Reference...
Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab)
Product Name : Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab)synonym : null,productDescription : Anti-NCAM1 /...
Anti-CD52 Reference Antibody (alemtuzumab)
Product Name : Anti-CD52 Reference Antibody (alemtuzumab)synonym : null,productDescription : Anti-CD52 Reference Antibody (alemtuzumab)(CHA166)...
Anti-CD34 Mouse mAb
Product Name : Anti-CD34 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 41endotoxin : Nonepurity...
Anti-CD47 Reference Antibody (CC-90002)
Product Name : Anti-CD47 Reference Antibody (CC-90002)synonym : null,productDescription : Anti-CD47 Reference Antibody (CC-90002)(CHA165)...
Anti-CD47 Reference Antibody (magrolimab)
Product Name : Anti-CD47 Reference Antibody (magrolimab)synonym : null,productDescription : Anti-CD47 Reference Antibody (magrolimab)(CHA164)...
Anti-CD46 Reference Antibody (FOR46)
Product Name : Anti-CD46 Reference Antibody (FOR46)synonym : null,productDescription : Anti-CD46 Reference Antibody (FOR46)(CHA163)...
Anti-TNFRSF5 / CD40 Reference Antibody (dacetuzumab)
Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (dacetuzumab)synonym : null,productDescription : Anti-TNFRSF5 /...
Anti-TNFRSF5 / CD40 Reference Antibody (sotigalimab)
Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (sotigalimab)synonym : null,productDescription : Anti-TNFRSF5 /...
Anti-TNFRSF5 / CD40 Reference Antibody (bleselumab)
Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (bleselumab)synonym : null,productDescription : Anti-TNFRSF5 /...
Anti-ENTPD1 / CD39 Reference Antibody (TTX-030)
Product Name : Anti-ENTPD1 / CD39 Reference Antibody (TTX-030)synonym : null,productDescription : Anti-ENTPD1 /...
Anti-FcgR2a / CD32a Reference Antibody (VIB9600)
Product Name : Anti-FcgR2a / CD32a Reference Antibody (VIB9600)synonym : null,productDescription : Anti-FcgR2a /...
Anti-TNFRSF17 / BCMA / CD269 Reference Antibody (belantamab)
Product Name : Anti-TNFRSF17 / BCMA / CD269 Reference Antibody (belantamab)synonym : null,productDescription :...
Anti-IL-2Ra / CD25 Reference Antibody (basiliximab)
Product Name : Anti-IL-2Ra / CD25 Reference Antibody (basiliximab)synonym : null,productDescription : Anti-IL-2Ra /...
Anti-TNFRSF8 / CD30 Rabbit mAb
Product Name : Anti-TNFRSF8 / CD30 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 64endotoxin...
Anti-OX2R / CD200R1 Reference Antibody (Janssen patent anti-CD200R1)
Product Name : Anti-OX2R / CD200R1 Reference Antibody (Janssen patent anti-CD200R1)synonym : null,productDescription :...
Anti-CD200 Reference Antibody (samalizumab)
Product Name : Anti-CD200 Reference Antibody (samalizumab)synonym : null,productDescription : Anti-CD200 Reference Antibody (samalizumab)(CHA148)...
Anti-PROM1 / CD133 Reference Antibody (Forerunner patent anti-Prominin-1)
Product Name : Anti-PROM1 / CD133 Reference Antibody (Forerunner patent anti-Prominin-1)synonym : null,productDescription :...
Anti-IL-3Ra / CD123 Reference Antibody (talacotuzumab)
Product Name : Anti-IL-3Ra / CD123 Reference Antibody (talacotuzumab)synonym : null,productDescription : Anti-IL-3Ra /...
Anti-IL-3Ra / CD123 Reference Antibody (SNG-CD123A)
Product Name : Anti-IL-3Ra / CD123 Reference Antibody (SNG-CD123A)synonym : null,productDescription : Anti-IL-3Ra /...
Anti-SCFR / c-Kit / CD117 Reference Antibody (LOP628)
Product Name : Anti-SCFR / c-Kit / CD117 Reference Antibody (LOP628)synonym : null,productDescription :...
Anti-CCR7 / CD197 Reference Antibody (R707)
Product Name : Anti-CCR7 / CD197 Reference Antibody (R707)synonym : null,productDescription : Anti-CCR7 /...
Anti-CCR4 / CD194 Reference Antibody (mogamulizumab)
Product Name : Anti-CCR4 / CD194 Reference Antibody (mogamulizumab)synonym : null,productDescription : Anti-CCR4 /...
Anti-CCR2 / CD192 Reference Antibody (plozalizumab)
Product Name : Anti-CCR2 / CD192 Reference Antibody (plozalizumab)synonym : null,productDescription : Anti-CCR2 /...
Anti-CCL5 / RANTES Reference Antibody (VLST-002)
Product Name : Anti-CCL5 / RANTES Reference Antibody (VLST-002)synonym : null,productDescription : Anti-CCL5 /...
Anti-FceR2 / CD23 Mouse mAb
Product Name : Anti-FceR2 / CD23 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 36endotoxin...
Anti-CTSS / Cathepsin S Reference Antibody (Fsn0503h)
Product Name : Anti-CTSS / Cathepsin S Reference Antibody (Fsn0503h)synonym : null,productDescription : Anti-CTSS...
Anti-CA9 / CAIX Reference Antibody (girentuximab)
Product Name : Anti-CA9 / CAIX Reference Antibody (girentuximab)synonym : productDescription : Anti-CA9 /...
Anti-CDH6 / K-Cadherin Reference Antibody (HKT288)
Product Name : Anti-CDH6 / K-Cadherin Reference Antibody (HKT288)synonym : null,productDescription : Anti-CDH6 /...
Anti-Complement C5aR1 Reference Antibody (G2_anti-C5aR)
Product Name : Anti-Complement C5aR1 Reference Antibody (G2_anti-C5aR)synonym : null,productDescription : Anti-Complement C5aR1 Reference...
Anti-C1s Reference Antibody (sutimlimab)
Product Name : Anti-C1s Reference Antibody (sutimlimab)synonym : null,productDescription : Anti-C1s Reference Antibody (sutimlimab)(CHA129)...
Anti-BST2 / CD317 Reference Antibody (XmAb 5592)
Product Name : Anti-BST2 / CD317 Reference Antibody (XmAb 5592)synonym : null,productDescription : Anti-BST2...
Anti-Klotho Beta Reference Antibody (NGM313)
Product Name : Anti-Klotho Beta Reference Antibody (NGM313)synonym : null,productDescription : Anti-Klotho Beta Reference...
Anti-Klotho Beta Reference Antibody (RG7992)
Product Name : Anti-Klotho Beta Reference Antibody (RG7992)synonym : null,productDescription : Anti-Klotho Beta Reference...
Anti-Bcl-2 Reference Antibody (U.Toronto patent anti-Bax)
Product Name : Anti-Bcl-2 Reference Antibody (U.Toronto patent anti-Bax)synonym : null,productDescription : Anti-Bcl-2 Reference...
Anti-TNFSF13B / BAFF / CD257 Reference Antibody (belimumab)
Product Name : Anti-TNFSF13B / BAFF / CD257 Reference Antibody (belimumab)synonym : null,productDescription :...
Anti-CD21 Rabbit mAb
Product Name : Anti-CD21 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 113endotoxin : Nonepurity...
Anti-B7-H6 / NCR3LG1 Reference Antibody (Dartmouth patent anti-B7-H6)
Product Name : Anti-B7-H6 / NCR3LG1 Reference Antibody (Dartmouth patent anti-B7-H6)synonym : null,productDescription :...
Anti-B7-H5 / VISTA Reference Antibody (onvatilimab)
Product Name : Anti-B7-H5 / VISTA Reference Antibody (onvatilimab)synonym : null,productDescription : Anti-B7-H5 /...
Anti-B7-H3 / CD276 Reference Antibody (enoblituzumab)
Product Name : Anti-B7-H3 / CD276 Reference Antibody (enoblituzumab)synonym : null,productDescription : Anti-B7-H3 /...
Anti-TNFSF13 / APRIL / CD256 Reference Antibody (BION-1301)
Product Name : Anti-TNFSF13 / APRIL / CD256 Reference Antibody (BION-1301)synonym : null,productDescription :...
Anti-Serum Amyloid P / SAP Reference Antibody (dezamizumab)
Product Name : Anti-Serum Amyloid P / SAP Reference Antibody (dezamizumab)synonym : null,productDescription :...
Anti-ANGPTL3 Reference Antibody (evinacumab)
Product Name : Anti-ANGPTL3 Reference Antibody (evinacumab)synonym : null,productDescription : Anti-ANGPTL3 Reference Antibody (evinacumab)(CHA116)...
Anti-ANGPT2 Reference Antibody (nesvacumab)
Product Name : Anti-ANGPT2 Reference Antibody (nesvacumab)synonym : null,productDescription : Anti-ANGPT2 Reference Antibody (nesvacumab)(CHA115)...
Anti-Alpha-synuclein Reference Antibody (prasinezumab)
Product Name : Anti-Alpha-synuclein Reference Antibody (prasinezumab)synonym : null,productDescription : Anti-Alpha-synuclein Reference Antibody (prasinezumab)(CHA113)...
Anti-Alpha-synuclein Reference Antibody (cinpanemab)
Product Name : Anti-Alpha-synuclein Reference Antibody (cinpanemab)synonym : null,productDescription : Anti-Alpha-synuclein Reference Antibody (cinpanemab)(CHA112)...
Anti-ACVRL1 / ALK-1 Reference Antibody (ascrinvacumab)
Product Name : Anti-ACVRL1 / ALK-1 Reference Antibody (ascrinvacumab)synonym : null,productDescription : Anti-ACVRL1 /...
Anti-FcgR3a / CD16a Mouse mAb
Product Name : Anti-FcgR3a / CD16a Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 29endotoxin...
Anti-CD19 Rabbit mAb
Product Name : Anti-CD19 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 61 kDaendotoxin :...
Anti-ALCAM / CD166 Reference Antibody (AT002)
Product Name : Anti-ALCAM / CD166 Reference Antibody (AT002)synonym : null,productDescription : Anti-ALCAM /...
Anti-ALCAM / CD166 Reference Antibody (praluzatamab)
Product Name : Anti-ALCAM / CD166 Reference Antibody (praluzatamab)synonym : null,productDescription : Anti-ALCAM /...
Anti-ACVR2B Reference Antibody (bimagrumab)
Product Name : Anti-ACVR2B Reference Antibody (bimagrumab)synonym : null,productDescription : Anti-ACVR2B Reference Antibody (bimagrumab)(CHA108)...
Anti-ACVR2A Reference Antibody (Ab-14E1)
Product Name : Anti-ACVR2A Reference Antibody (Ab-14E1)synonym : null,productDescription : Anti-ACVR2A Reference Antibody (Ab-14E1)(CHA106)...
Anti-ACVR1 / ALK-2 Reference Antibody (DS-6016a)
Product Name : Anti-ACVR1 / ALK-2 Reference Antibody (DS-6016a)synonym : null,productDescription : Anti-ACVR1 /...
Anti-TNFSF9 / 4-1BBL Reference Antibody (Abbvie patent anti-TNFSF9)
Product Name : Anti-TNFSF9 / 4-1BBL Reference Antibody (Abbvie patent anti-TNFSF9)synonym : null,productDescription :...
Anti-TNFRSF9 / 4-1BB / CD137 Reference Antibody (urelumab)
Product Name : Anti-TNFRSF9 / 4-1BB / CD137 Reference Antibody (urelumab)synonym : null,productDescription :...
Anti-TNFRSF9 / 4-1BB / CD137 Reference Antibody (utomilumab)
Product Name : Anti-TNFRSF9 / 4-1BB / CD137 Reference Antibody (utomilumab)synonym : null,productDescription :...
Anti-VEGFR2 / KDR / CD309 Reference Antibody (ramucirumab)
Product Name : Anti-VEGFR2 / KDR / CD309 Reference Antibody (ramucirumab)synonym : null,productDescription :...
Anti-VEGFA Reference Antibody (bevacizumab)
Product Name : Anti-VEGFA Reference Antibody (bevacizumab)synonym : null,productDescription : Anti-VEGFA Reference Antibody (bevacizumab)(CHA099)...
Anti-CD14 Rabbit mAb
Product Name : Anti-CD14 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 40endotoxin : Nonepurity...
Anti-TNFSF2 / TNFa Reference Antibody (infliximab)
Product Name : Anti-TNFSF2 / TNFa Reference Antibody (infliximab)synonym : null,productDescription : Anti-TNFSF2 /...
Anti-TNFSF2 / TNFa Reference Antibody (adalimumab)
Product Name : Anti-TNFSF2 / TNFa Reference Antibody (adalimumab)synonym : null,productDescription : Anti-TNFSF2 /...
Anti-TIGIT Reference Antibody (tiragolumab)
Product Name : Anti-TIGIT Reference Antibody (tiragolumab)synonym : null,productDescription : Anti-TIGIT Reference Antibody (tiragolumab)(CHA096)...
Anti-SLAMF7 / CS1 Reference Antibody (elotuzumab)
Product Name : Anti-SLAMF7 / CS1 Reference Antibody (elotuzumab)synonym : null,productDescription : Anti-SLAMF7 /...
Anti-Siglec-8 Reference Antibody (lirentelimab)
Product Name : Anti-Siglec-8 Reference Antibody (lirentelimab)synonym : null,productDescription : Anti-Siglec-8 Reference Antibody (lirentelimab)(CHA094)...
Anti-Siglec-15 / CD33L3 Reference Antibody (NC318)
Product Name : Anti-Siglec-15 / CD33L3 Reference Antibody (NC318)synonym : null,productDescription : Anti-Siglec-15 /...
Anti-ROR1 Reference Antibody (zilovertamab)
Product Name : Anti-ROR1 Reference Antibody (zilovertamab)synonym : null,productDescription : Anti-ROR1 Reference Antibody (zilovertamab)(CHA092)...
Anti-RGMA Reference Antibody (elezanumab)
Product Name : Anti-RGMA Reference Antibody (elezanumab)synonym : null,productDescription : Anti-RGMA Reference Antibody (elezanumab)(CHA091)...
Anti-FOLH1 / PSMA Reference Antibody (rosopatamab)
Product Name : Anti-FOLH1 / PSMA Reference Antibody (rosopatamab)synonym : null,productDescription : Anti-FOLH1 /...
Anti-PSGL1 / CD162 Reference Antibody (neihulizumab)
Product Name : Anti-PSGL1 / CD162 Reference Antibody (neihulizumab)synonym : productDescription : Anti-PSGL1 /...
Anti-CD13 Rabbit mAb
Product Name : Anti-CD13 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 110endotoxin : Nonepurity...
Anti-P-Selectin / CD62p Reference Antibody (crizanlizumab)
Product Name : Anti-P-Selectin / CD62p Reference Antibody (crizanlizumab)synonym : null,productDescription : Anti-P-Selectin /...
Anti-P-Selectin / CD62p Reference Antibody (inclacumab)
Product Name : Anti-P-Selectin / CD62p Reference Antibody (inclacumab)synonym : null,productDescription : Anti-P-Selectin /...
Anti-PMEL Reference Antibody (Novartis patent anti-PMEL17)
Product Name : Anti-PMEL Reference Antibody (Novartis patent anti-PMEL17)synonym : null,productDescription : Anti-PMEL Reference...
Anti-PMEL Reference Antibody (Genentech anti-PMEL17)
Product Name : Anti-PMEL Reference Antibody (Genentech anti-PMEL17)synonym : null,productDescription : Anti-PMEL Reference Antibody...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (durvalumab)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (durvalumab)synonym : null,productDescription :...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (atezolizumab)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (atezolizumab)synonym : null,productDescription :...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (MDX-1105)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (MDX-1105)synonym : null,productDescription :...
Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (avelumab)
Product Name : Anti-B7-H1 / PD-L1 / CD274 Reference Antibody (avelumab)synonym : null,productDescription :...
Anti-PDGFB Reference Antibody (MOR-8457)
Product Name : Anti-PDGFB Reference Antibody (MOR-8457)synonym : null,productDescription : Anti-PDGFB Reference Antibody (MOR-8457)(CHA080)...
Anti-PDCD1 / PD-1 / CD279 Reference Antibody (nivolumab)
Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (nivolumab)synonym : null,productDescription :...
Anti-Neprilysin / CD10 Mouse mAb
Product Name : Anti-Neprilysin / CD10 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 86endotoxin...
Anti-PDCD1 / PD-1 / CD279 Reference Antibody (pembrolizumab)
Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (pembrolizumab)synonym : null,productDescription :...
Anti-PDCD1 / PD-1 / CD279 Reference Antibody (camrelizumab)
Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (camrelizumab)synonym : null,productDescription :...
Anti-PDCD1 / PD-1 / CD279 Reference Antibody (spartalizumab)
Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (spartalizumab)synonym : null,productDescription :...
Anti-NT5E / CD73 Reference Antibody (oleclumab)
Product Name : Anti-NT5E / CD73 Reference Antibody (oleclumab)synonym : null,productDescription : Anti-NT5E /...
Anti-NKG2D / CD314 Reference Antibody (tesnatilimab)
Product Name : Anti-NKG2D / CD314 Reference Antibody (tesnatilimab)synonym : null,productDescription : Anti-NKG2D /...
Anti-Nectin-4 Reference Antibody (enfortumab)
Product Name : Anti-Nectin-4 Reference Antibody (enfortumab)synonym : null,productDescription : Anti-Nectin-4 Reference Antibody (enfortumab)(CHA073)...
Anti-CSF1 / M-CSF Reference Antibody (lacnotuzumab)
Product Name : Anti-CSF1 / M-CSF Reference Antibody (lacnotuzumab)synonym : null,productDescription : Anti-CSF1 /...
Anti-LILRB4 / ILT3 / CD85k Reference Antibody (U.Texas patent anti-LILRB4)
Product Name : Anti-LILRB4 / ILT3 / CD85k Reference Antibody (U.Texas patent anti-LILRB4)synonym :...
Anti-LILRB4 / ILT3 / CD85k Reference Antibody (Merck patent anti-ILT3 complex)
Product Name : Anti-LILRB4 / ILT3 / CD85k Reference Antibody (Merck patent anti-ILT3 complex)synonym...
Anti-LIF Reference Antibody (MSC-1)
Product Name : Anti-LIF Reference Antibody (MSC-1)synonym : null,productDescription : Anti-LIF Reference Antibody (MSC-1)(CHA069)...
Anti-CD8 Mouse mAb
Product Name : Anti-CD8 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 26endotoxin : Nonepurity...
Anti-KIR3DL2 / CD158k Reference Antibody (lacutamab)
Product Name : Anti-KIR3DL2 / CD158k Reference Antibody (lacutamab)synonym : null,productDescription : Anti-KIR3DL2 /...
Anti-KIR Reference Antibody (lirilumab)
Product Name : Anti-KIR Reference Antibody (lirilumab)synonym : null,productDescription : Anti-KIR Reference Antibody (lirilumab)(CHA067)...
Anti-IL-6Ra / CD126 Reference Antibody (tocilizumab)
Product Name : Anti-IL-6Ra / CD126 Reference Antibody (tocilizumab)synonym : null,productDescription : Anti-IL-6Ra /...
Anti-IL-6Ra / CD126 Reference Antibody (sarilumab)
Product Name : Anti-IL-6Ra / CD126 Reference Antibody (sarilumab)synonym : null,productDescription : Anti-IL-6Ra /...
Anti-IL-6Ra / CD126 Reference Antibody (vobarilizumab)
Product Name : Anti-IL-6Ra / CD126 Reference Antibody (vobarilizumab)synonym : null,productDescription : Anti-IL-6Ra /...
Anti-IL-6 / IFNb2 Reference Antibody (clazakizumab)
Product Name : Anti-IL-6 / IFNb2 Reference Antibody (clazakizumab)synonym : null,productDescription : Anti-IL-6 /...
Anti-IL-21 Reference Antibody (Lilly patent anti-IL-21)
Product Name : Anti-IL-21 Reference Antibody (Lilly patent anti-IL-21)synonym : null,productDescription : Anti-IL-21 Reference...
Anti-IL-1RAP / IL-1R3 Reference Antibody (nidanilimab)
Product Name : Anti-IL-1RAP / IL-1R3 Reference Antibody (nidanilimab)synonym : null,productDescription : Anti-IL-1RAP /...
Anti-IL-18 Reference Antibody (GSK 1070806)
Product Name : Anti-IL-18 Reference Antibody (GSK 1070806)synonym : null,productDescription : Anti-IL-18 Reference Antibody...
Anti-IL-17Ra / CD217 Reference Antibody (brodalumab)
Product Name : Anti-IL-17Ra / CD217 Reference Antibody (brodalumab)synonym : null,productDescription : Anti-IL-17Ra /...
Anti-CD7 Mouse mAb
Product Name : Anti-CD7 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 25endotoxin : Nonepurity...
Anti-IL-15 Reference Antibody (ordesekimab)
Product Name : Anti-IL-15 Reference Antibody (ordesekimab)synonym : null,productDescription : Anti-IL-15 Reference Antibody (ordesekimab)(CHA055)...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (pertuzumab)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (pertuzumab)synonym : null,productDescription :...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (trastuzumab)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (trastuzumab)synonym : null,productDescription :...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (zanidatamab)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (zanidatamab)synonym : null,productDescription :...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (disitamab)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (disitamab)synonym : null,productDescription :...
Anti-GPC3 / Glypican-3 Reference Antibody (codrituzumab)
Product Name : Anti-GPC3 / Glypican-3 Reference Antibody (codrituzumab)synonym : null,productDescription : Anti-GPC3 /...
Anti-FOLR1 / FRA Reference Antibody (mirvetuximab)
Product Name : Anti-FOLR1 / FRA Reference Antibody (mirvetuximab)synonym : null,productDescription : Anti-FOLR1 Reference...
Anti-FOLR1 / FRA Reference Antibody (farletuzumab)
Product Name : Anti-FOLR1 / FRA Reference Antibody (farletuzumab)synonym : null,productDescription : Anti-FOLR1 Reference...
Anti-FGFR2 / CD332 Reference Antibody (aprutumab)
Product Name : Anti-FGFR2 / CD332 Reference Antibody (aprutumab)synonym : null,productDescription : Anti-FGFR2 /...
Anti-FGFR2 / CD332 Reference Antibody (bemarituzumab)
Product Name : Anti-FGFR2 / CD332 Reference Antibody (bemarituzumab)synonym : null,productDescription : Anti-FGFR2 /...
Anti-CD5 Rabbit mAb
Product Name : Anti-CD5 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 55endotoxin : Nonepurity...
Anti-FcRn (FCGRT & B2M) Reference Antibody (rozanolixizumab)
Product Name : Anti-FcRn (FCGRT & B2M) Reference Antibody (rozanolixizumab)synonym : null,productDescription : Anti-FcRn...
Anti-EphA2 Reference Antibody (Sanofi Aventis patent anti-EphA2)
Product Name : Anti-EphA2 Reference Antibody (Sanofi Aventis patent anti-EphA2)synonym : null,productDescription : Anti-EphA2...
Anti-EphA2 Reference Antibody (MEDI-547)
Product Name : Anti-EphA2 Reference Antibody (MEDI-547)synonym : null,productDescription : Anti-EphA2 Reference Antibody (MEDI-547)(CHA043)...
Anti-ERBB1 / EGFR / HER1 Reference Antibody (cetuximab)
Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (cetuximab)synonym : null,productDescription :...
Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (tigatuzumab)
Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (tigatuzumab)synonym : null,productDescription :...
Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (conatumumab)
Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (conatumumab)synonym : null,productDescription :...
Anti-DLL3 Reference Antibody (Dragonfly patent anti-DLL3)
Product Name : Anti-DLL3 Reference Antibody (Dragonfly patent anti-DLL3)synonym : null,productDescription : Anti-DLL3 Reference...
Anti-DLL3 Reference Antibody (rovalpituzumab)
Product Name : Anti-DLL3 Reference Antibody (rovalpituzumab)synonym : null,productDescription : Anti-DLL3 Reference Antibody (rovalpituzumab)(CHA037)...
Anti-LY75 / CD205/DEC-205 Reference Antibody (CDX-1401)
Product Name : Anti-LY75 / CD205/DEC-205 Reference Antibody (CDX-1401)synonym : null,productDescription : Anti-LY75 /...
Anti-LY75 / CD205/DEC-205 Reference Antibody (MEN1309)
Product Name : Anti-LY75 / CD205/DEC-205 Reference Antibody (MEN1309)synonym : null,productDescription : Anti-LY75 /...
Anti-CD4 Rabbit mAb
Product Name : Anti-CD4 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 51endotoxin : Nonepurity...
Anti-CXCR4 / CD184 Reference Antibody (ulocuplumab)
Product Name : Anti-CXCR4 / CD184 Reference Antibody (ulocuplumab)synonym : null,productDescription : Anti-CXCR4 /...
Anti-CX3CL1 / Fractalkine Reference Antibody (quetmolimab)
Product Name : Anti-CX3CL1 / Fractalkine Reference Antibody (quetmolimab)synonym : null,productDescription : Anti-CX3CL1 /...
Anti-CTLA-4 / CD152 Reference Antibody (ipilimumab)
Product Name : Anti-CTLA-4 / CD152 Reference Antibody (ipilimumab)synonym : null,productDescription : Anti-CTLA-4 /...
Anti-CCN2 / CTGF Reference Antibody (pamrevlumab)
Product Name : Anti-CCN2 / CTGF Reference Antibody (pamrevlumab)synonym : null,productDescription : Anti-CCN2 /...
Anti-HGFR / c-Met Reference Antibody (onartuzumab)
Product Name : Anti-HGFR / c-Met Reference Antibody (onartuzumab)synonym : null,productDescription : Anti-HGFR /...
Anti-HGFR / c-Met Reference Antibody (telisotuzumab)
Product Name : Anti-HGFR / c-Met Reference Antibody (telisotuzumab)synonym : null,productDescription : Anti-HGFR /...
Anti-HGFR / c-Met Reference Antibody (amivantamab)
Product Name : Anti-HGFR / c-Met Reference Antibody (amivantamab)synonym : null,productDescription : Anti-HGFR /...
Anti-TNFSF7 / CD27L / CD70 Reference Antibody (vorsetuzumab)
Product Name : Anti-TNFSF7 / CD27L / CD70 Reference Antibody (vorsetuzumab)synonym : null,productDescription :...
Anti-CD7 Reference Antibody (Persongen patent anti-CD7)
Product Name : Anti-CD7 Reference Antibody (Persongen patent anti-CD7)synonym : null,productDescription : Anti-CD7 Reference...
Anti-CD5 Reference Antibody (Magenta patent anti-CD5)
Product Name : Anti-CD5 Reference Antibody (Magenta patent anti-CD5)synonym : null,productDescription : Anti-CD5 Reference...
Anti-CD2 Rabbit mAb
Product Name : Anti-CD2 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 39endotoxin : Nonepurity...
Anti-CD38 Reference Antibody (daratumumab)
Product Name : Anti-CD38 Reference Antibody (daratumumab)synonym : null,productDescription : Anti-CD38 Reference Antibody (daratumumab)(CHA024)...
Anti-TSPAN26 / CD37 Reference Antibody (naratuximab)
Product Name : Anti-TSPAN26 / CD37 Reference Antibody (naratuximab)synonym : null,productDescription : Anti-TSPAN26 /...
Anti-Siglec-3 / CD33 Reference Antibody (vadastuximab)
Product Name : Anti-Siglec-3 / CD33 Reference Antibody (vadastuximab)synonym : null,productDescription : Anti-Siglec-3 /...
Anti-TNFRSF8 / CD30 Reference Antibody (brentuximab)
Product Name : Anti-TNFRSF8 / CD30 Reference Antibody (brentuximab)synonym : null,productDescription : Anti-TNFRSF8 /...
Anti-TNFRSF7 / CD27 Reference Antibody (varlilumab)
Product Name : Anti-TNFRSF7 / CD27 Reference Antibody (varlilumab)synonym : null,productDescription : Anti-TNFRSF7 /...
Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab)
Product Name : Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab)synonym : null,productDescription : Anti-Siglec-2 /...
Anti-IGF1R / CD221 Reference Antibody (cixutumumab)
Product Name : Anti-IGF1R / CD221 Reference Antibody (cixutumumab)synonym : null,productDescription : Anti-IGF1R /...
Anti-CD20 / MS4A1 Reference Antibody (obinutuzumab)
Product Name : Anti-CD20 / MS4A1 Reference Antibody (obinutuzumab)synonym : null,productDescription : Anti-CD20 Reference...
Anti-CD20 / MS4A1 Reference Antibody (rituximab)
Product Name : Anti-CD20 / MS4A1 Reference Antibody (rituximab)synonym : null,productDescription : Anti-CD20 Reference...
Anti-CD19 Reference Antibody (tafasitamab)
Product Name : Anti-CD19 Reference Antibody (tafasitamab)synonym : null,productDescription : Anti-CD19 Reference Antibody (tafasitamab)(CHA014)...
Anti-CD1a Mouse mAb
Product Name : Anti-CD1a Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 37endotoxin : Nonepurity...
Anti-CD19 Reference Antibody (inebilizumab)
Product Name : Anti-CD19 Reference Antibody (inebilizumab)synonym : null,productDescription : Anti-CD19 Reference Antibody (inebilizumab)(CHA013)...
Anti-Spike S1 Reference Antibody (CR3022)
Product Name : Anti-Spike S1 Reference Antibody (CR3022)synonym : null,productDescription : Anti-Spike S1 Reference...
Anti-MERS Reference Antibody (D12)
Product Name : Anti-MERS Reference Antibody (D12)synonym : null,productDescription : Anti-MERS Reference Antibody (D12)(CHA004)...
Anti-MERS Reference Antibody (3A1)
Product Name : Anti-MERS Reference Antibody (3A1)synonym : null,productDescription : Anti-MERS Reference Antibody (3A1)(CHA003)...
Anti-MERS Reference Antibody (2E6)
Product Name : Anti-MERS Reference Antibody (2E6)synonym : null,productDescription : Anti-MERS Reference Antibody (2E6)(CHA002)...
Anti-SARS Reference Antibody (80R )
Product Name : Anti-SARS Reference Antibody (80R )synonym : null,productDescription : Anti-SARS Reference Antibody...
Anti-H3L Antibody (NAL_A185)
Product Name : Anti-H3L Antibody (NAL_A185)synonym : null,productDescription : Anti-H3L Antibody (AVA004) is expressed...
Anti-E8L Antibody (NL_A151)
Product Name : Anti-E8L Antibody (NL_A151)synonym : null,productDescription : Anti-E8L Antibody (AVA003) is expressed...
Anti-Spike RBD (Omicron BA.2 / BA.2.75) Antibody (dAb-708)
Product Name : Anti-Spike RBD (Omicron BA.2 / BA.2.75) Antibody (dAb-708)synonym : productDescription :...
Anti-Spike S1 (Omicron BA.2 / BA.2.75 / BA.4 / BA.5) Antibody (THS-699)
Product Name : Anti-Spike S1 (Omicron BA.2 / BA.2.75 / BA.4 / BA.5) Antibody...
Anti-Calretinin Rabbit mAb
Product Name : Anti-Calretinin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 32endotoxin : Nonepurity...
Anti-CD3d Rabbit mAb
Product Name : Anti-CD3d Rabbit mAbsynonym : productDescription : NonemolecularWeight : 19 kDaendotoxin :...
Anti-Spike S1 Antibody (NCOV-S1P14-Fc)
Product Name : Anti-Spike S1 Antibody (NCOV-S1P14-Fc)synonym : null,productDescription : Anti-Spike S1 Antibody (NCOV-S1P14-Fc)(ANA005)...
Anti-Spike RBD Antibody (RP1-E4)
Product Name : Anti-Spike RBD Antibody (RP1-E4)synonym : null,productDescription : Anti-Spike RBD Antibody (RP1-E4)(ANA004)...
Anti-Spike RBD Antibody (RP1-H5)
Product Name : Anti-Spike RBD Antibody (RP1-H5)synonym : null,productDescription : Anti-Spike RBD Antibody (RP1-H5)(ANA003)...
Anti-Spike RBD Antibody (RP6-E2)
Product Name : Anti-Spike RBD Antibody (RP6-E2)synonym : null,productDescription : Anti-Spike RBD Antibody (RP6-E2)(ANA002)...
Anti-Spike RBD Antibody (RP6-E3)
Product Name : Anti-Spike RBD Antibody (RP6-E3)synonym : null,productDescription : Anti-Spike RBD Antibody (RP6-E3)(ANA001)...
Anti-CTLA-8 / IL-17a Antibody (SY18-VHH-11)
Product Name : Anti-CTLA-8 / IL-17a Antibody (SY18-VHH-11)synonym : null,productDescription : Anti-CTLA-8 / IL-17a...
Anti-Spike RBD (Omicron) Antibody (P26130)
Product Name : Anti-Spike RBD (Omicron) Antibody (P26130)synonym : null,productDescription : Anti-Spike RBD (Omicron)...
Anti-Spike RBD Antibody (R15-F7)
Product Name : Anti-Spike RBD Antibody (R15-F7)synonym : null,productDescription : Anti-Spike RBD Antibody (R15-F7)(AHA020)...
Anti-Nucleocapsid Antibody (N-P11)
Product Name : Anti-Nucleocapsid Antibody (N-P11)synonym : null,productDescription : Anti-Nucleocapsid Antibody (N-P11)(AHA018) is expressed...
Anti-Nucleocapsid Antibody (N-P10)
Product Name : Anti-Nucleocapsid Antibody (N-P10)synonym : null,productDescription : Anti-Nucleocapsid Antibody (N-P10)(AHA017) is expressed...
Anti-Calponin Mouse mAb
Product Name : Anti-Calponin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 33endotoxin : Nonepurity...
Anti-Spike RBD Antibody (R16-F10)
Product Name : Anti-Spike RBD Antibody (R16-F10)synonym : null,productDescription : Anti-Spike RBD Antibody (R16-F10)(AHA014)...
Anti-Spike RBD Antibody (R14-F8)
Product Name : Anti-Spike RBD Antibody (R14-F8)synonym : null,productDescription : Anti-Spike RBD Antibody (R14-F8)(AHA013)...
Anti-Nucleocapsid Antibody (N-18)
Product Name : Anti-Nucleocapsid Antibody (N-18)synonym : null,productDescription : Anti-Nucleocapsid Antibody (N-18)(AHA009) is expressed...
Anti-ACE2 Antibody (NCOV-7)
Product Name : Anti-ACE2 Antibody (NCOV-7)synonym : null,productDescription : Anti-ACE2 Antibody (NCOV-7)(AHA007) is expressed...
Anti-Nucleocapsid Antibody (N-9)
Product Name : Anti-Nucleocapsid Antibody (N-9)synonym : null,productDescription : Anti-Nucleocapsid Antibody (N-9)(AHA006) is expressed...
Anti-Spike RBD Antibody (P17-A11)
Product Name : Anti-Spike RBD Antibody (P17-A11)synonym : null,productDescription : Anti-Spike RBD Antibody (P17-A11)(AHA004)...
Anti-Spike RBD Antibody (P20-B4)
Product Name : Anti-Spike RBD Antibody (P20-B4)synonym : null,productDescription : Anti-Spike RBD Antibody (P20-B4)(AHA003)...
Anti-Spike RBD Antibody (P16-A3)
Product Name : Anti-Spike RBD Antibody (P16-A3)synonym : null,productDescription : Anti-Spike RBD Antibody (P16-A3)(AHA001)...
Anti-NSE Mouse mAb
Product Name : Anti-NSE Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 47endotoxin : Nonepurity...
Anti-HIF-1α Rabbit mAb
Product Name : Anti-HIF-1α Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 93endotoxin : Nonepurity...
Anti-Caldesmon Rabbit mAb
Product Name : Anti-Caldesmon Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 93endotoxin : Nonepurity...
Anti-Gastrin Rabbit mAb
Product Name : Anti-Gastrin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 11endotoxin : Nonepurity...
Anti-CD99 Rabbit mAb
Product Name : Anti-CD99 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 19endotoxin : Nonepurity...
Anti-IL-3Ra / CD123 Rabbit mAb
Product Name : Anti-IL-3Ra / CD123 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 43endotoxin...
Anti-ZAP-70 Rabbit mAb
Product Name : Anti-ZAP-70 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 70endotoxin : Nonepurity...
Anti-WT1 Mouse mAb
Product Name : Anti-WT1 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 49endotoxin : Nonepurity...
Anti-VIP Mouse mAb
Product Name : Anti-VIP Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 19endotoxin : Nonepurity...
Anti-Vimentin Mouse mAb
Product Name : Anti-Vimentin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 54endotoxin : Nonepurity...
Anti-Villin Rabbit mAb
Product Name : Anti-Villin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 93endotoxin : Nonepurity...
Anti-VHL Mouse mAb
Product Name : Anti-VHL Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 24endotoxin : Nonepurity...
Anti-VEGFR2 / KDR / CD309Rabbit mAb
Product Name : Anti-VEGFR2 / KDR / CD309Rabbit mAbsynonym : null,productDescription : NonemolecularWeight :...
Anti-Calcitonin Rabbit mAb
Product Name : Anti-Calcitonin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 15endotoxin : Nonepurity...
Anti-Tyrosinase Mouse mAb
Product Name : Anti-Tyrosinase Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 60endotoxin : Nonepurity...
Anti-β-tubulin-III Mouse mAb
Product Name : Anti-β-tubulin-III Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 50endotoxin : Nonepurity...
Anti-TTF-1 Mouse mAb
Product Name : Anti-TTF-1 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 39endotoxin : Nonepurity...
Anti-Tryptase Mouse mAb
Product Name : Anti-Tryptase Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 31endotoxin : Nonepurity...
Anti-TPO Mouse mAb
Product Name : Anti-TPO Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 103endotoxin : Nonepurity...
Anti-TOP2A Mouse mAb
Product Name : Anti-TOP2A Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 174endotoxin : Nonepurity...
Anti-TIA-1 Mouse mAb
Product Name : Anti-TIA-1 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 43endotoxin : Nonepurity...
Anti-TS Mouse mAb
Product Name : Anti-TS Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 36endotoxin : Nonepurity...
Anti-Thyroid Stimulating Hormone Mouse mAb
Product Name : Anti-Thyroid Stimulating Hormone Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 16endotoxin...
Anti-TROP2Mouse mAb
Product Name : Anti-TROP2Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 36endotoxin : Nonepurity :...
Anti-CA9 / CAIXMouse mAb
Product Name : Anti-CA9 / CAIXMouse mAbsynonym : null,productDescription : NonemolecularWeight : 50endotoxin :...
Anti-Synaptophysin Mouse mAb
Product Name : Anti-Synaptophysin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 34endotoxin : Nonepurity...
Anti-STAT6 Mouse mAb
Product Name : Anti-STAT6 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 94endotoxin : Nonepurity...
Anti-SOX10 Mouse mAb
Product Name : Anti-SOX10 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 50endotoxin : Nonepurity...
Anti-Somatostatin Mouse mAb
Product Name : Anti-Somatostatin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 13endotoxin : Nonepurity...
Anti-SMARCA4 / Brg1 Rabbit mAb
Product Name : Anti-SMARCA4 / Brg1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 185endotoxin...
Anti-SMA Rabbit mAb
Product Name : Anti-SMA Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 42endotoxin : Nonepurity...
Anti-SDHA Mouse mAb
Product Name : Anti-SDHA Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 73endotoxin : Nonepurity...
Anti-S100P Mouse mAb
Product Name : Anti-S100P Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 10endotoxin : Nonepurity...
Anti-FOLH1 / PSMA Mouse mAb
Product Name : Anti-FOLH1 / PSMA Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 84endotoxin...
Anti-PSAP Rabbit mAb
Product Name : Anti-PSAP Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 58endotoxin : Nonepurity...
Anti-C4d Mouse mAb
Product Name : Anti-C4d Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 193endotoxin : Nonepurity...
Anti-PSA Mouse mAb
Product Name : Anti-PSA Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 29endotoxin : Nonepurity...
Anti-Protein Gene Product 9.5 Mouse mAb
Product Name : Anti-Protein Gene Product 9.5 Mouse mAbsynonym : null,productDescription : NonemolecularWeight :...
Anti-Podoplanin Mouse mAb
Product Name : Anti-Podoplanin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 17endotoxin : Nonepurity...
Anti-PMS2 Rabbit mAb
Product Name : Anti-PMS2 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 96endotoxin : Nonepurity...
Anti-PLAP Mouse mAb
Product Name : Anti-PLAP Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 58endotoxin : Nonepurity...
Anti-PCNA Rabbit mAb
Product Name : Anti-PCNA Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 29endotoxin : Nonepurity...
Anti-Pax8 Rabbit mAb
Product Name : Anti-Pax8 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 48endotoxin : Nonepurity...
Anti-Pax-5 Mouse mAb
Product Name : Anti-Pax-5 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 42endotoxin : Nonepurity...
Anti-p120 Rabbit mAb
Product Name : Anti-p120 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 91endotoxin : Nonepurity...
Anti-p63 Rabbit mAb
Product Name : Anti-p63 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 77endotoxin : Nonepurity...
Anti-BOB.1 Mouse mAb
Product Name : Anti-BOB.1 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 27endotoxin : Nonepurity...
Anti-p57 Mouse mAb
Product Name : Anti-p57 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 32endotoxin : Nonepurity...
Anti-p27 Mouse mAb
Product Name : Anti-p27 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 22endotoxin : Nonepurity...
Anti-p16 Mouse mAb
Product Name : Anti-p16 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 17endotoxin : Nonepurity...
Anti-NSE Rabbit mAb
Product Name : Anti-NSE Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 47endotoxin : Nonepurity...
Anti-nm23 Mouse mAb
Product Name : Anti-nm23 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 17endotoxin : Nonepurity...
Anti-NGFR Mouse mAb
Product Name : Anti-NGFR Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 45endotoxin : Nonepurity...
Anti-Neurofilament Rabbit mAb
Product Name : Anti-Neurofilament Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 102endotoxin : Nonepurity...
Anti-NeuN Rabbit mAb
Product Name : Anti-NeuN Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 34endotoxin : Nonepurity...
Anti-Nestin Mouse mAb
Product Name : Anti-Nestin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 177endotoxin : Nonepurity...
Anti-Napsin A Rabbit mAb
Product Name : Anti-Napsin A Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 45endotoxin :...
Anti-Bcl-6 Mouse mAb
Product Name : Anti-Bcl-6 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 79endotoxin : Nonepurity...
Anti-Myoglobin Rabbit mAb
Product Name : Anti-Myoglobin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 17endotoxin : Nonepurity...
Anti-MyoD1 Rabbit mAb
Product Name : Anti-MyoD1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 35endotoxin : Nonepurity...
Anti-Myeloperoxidase Mouse mAb
Product Name : Anti-Myeloperoxidase Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 84endotoxin : Nonepurity...
Anti-Myelin Basic Protein Rabbit mAb
Product Name : Anti-Myelin Basic Protein Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 33endotoxin...
Anti-MUM1 Rabbit mAb
Product Name : Anti-MUM1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 79endotoxin : Nonepurity...
Anti-RSV-F Reference Antibody (palivizumab)
Product Name : Anti-RSV-F Reference Antibody (palivizumab)synonym : null,productDescription : Anti-RSV-F Reference Antibody (palivizumab)(CVA006)...
Anti-RSV-F Reference Antibody (motavizumab)
Product Name : Anti-RSV-F Reference Antibody (motavizumab)synonym : null,productDescription : Anti-RSV-F Reference Antibody (motavizumab)(CVA005)...
Anti-Rabies virus GP Reference Antibody (rafivirumab)
Product Name : Anti-Rabies virus GP Reference Antibody (rafivirumab)synonym : null,productDescription : Anti-Rabies virus...
Anti-Rabies virus GP Reference Antibody (foravirumab)
Product Name : Anti-Rabies virus GP Reference Antibody (foravirumab)synonym : null,productDescription : Anti-Rabies virus...
Anti-HBsAg Reference Antibody (OST 577)
Product Name : Anti-HBsAg Reference Antibody (OST 577)synonym : null,productDescription : Anti-HBsAg Reference Antibody...
Anti-CLDN6 Reference Antibody (IM-302)
Product Name : Anti-CLDN6 Reference Antibody (IM-302)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (IM-302)...
Anti-MUC6 Mouse mAb
Product Name : Anti-MUC6 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 257endotoxin : Nonepurity...
Anti-CLDN6 Reference Antibody (IM-301)
Product Name : Anti-CLDN6 Reference Antibody (IM-301)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (IM-301)...
Anti-Shiga toxin (E.coli) Reference Antibody (setoxaximab)
Product Name : Anti-Shiga toxin (E.coli) Reference Antibody (setoxaximab)synonym : null,productDescription : Anti-Shiga toxin...
Anti-Shiga toxin (E.coli) Reference Antibody (pritoxaximab)
Product Name : Anti-Shiga toxin (E.coli) Reference Antibody (pritoxaximab)synonym : null,productDescription : Anti-Shiga toxin...
Anti-Abm Reference Antibody ( IgG4+Kappa Isotype Control)
Product Name : Anti-Abm Reference Antibody ( IgG4+Kappa Isotype Control)synonym : null,productDescription : Anti-Abm...
Anti-Abm Reference Antibody ( IgG1+Kappa Isotype Control)
Product Name : Anti-Abm Reference Antibody ( IgG1+Kappa Isotype Control)synonym : null,productDescription : Anti-Abm...
Anti-LIV-1 / SLC39A6 Mouse Antibody
Product Name : Anti-LIV-1 / SLC39A6 Mouse Antibodysynonym : null,productDescription : Anti-LIV-1 / SLC39A6 Mouse Antibody...
Anti-Tau Reference Antibody (A155)
Product Name : Anti-Tau Reference Antibody (A155)synonym : null,productDescription : NonemolecularWeight : 144.06 kDaendotoxin...
Anti-Tau Reference Antibody (A119)
Product Name : Anti-Tau Reference Antibody (A119)synonym : null,productDescription : NonemolecularWeight : 145.54 kDaendotoxin...
Anti-Tau Reference Antibody (A080)
Product Name : Anti-Tau Reference Antibody (A080)synonym : null,productDescription : NonemolecularWeight : 145.32 kDaendotoxin...
Anti-Tau Reference Antibody (A105)
Product Name : Anti-Tau Reference Antibody (A105)synonym : null,productDescription : NonemolecularWeight : 144.62 kDaendotoxin...
Anti-MUC5AC Mouse mAb
Product Name : Anti-MUC5AC Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 586endotoxin : Nonepurity...
Anti-Tau Reference Antibody (A103)
Product Name : Anti-Tau Reference Antibody (A103)synonym : null,productDescription : NonemolecularWeight : 143.94 kDaendotoxin...
Anti-Tau Reference Antibody (A054)
Product Name : Anti-Tau Reference Antibody (A054)synonym : null,productDescription : NonemolecularWeight : 145.12 kDaendotoxin...
Anti-Tau Reference Antibody (pT217,rabbit IgG1)
Product Name : Anti-Tau Reference Antibody (pT217,rabbit IgG1)synonym : null,productDescription : NonemolecularWeight : 139.52...
Anti-Tau Reference Antibody (pT217,mouse IgG1)
Product Name : Anti-Tau Reference Antibody (pT217,mouse IgG1)synonym : null,productDescription : NonemolecularWeight : 141.94...
Anti-Tau Reference Antibody (pT217,human IgG1)
Product Name : Anti-Tau Reference Antibody (pT217,human IgG1)synonym : null,productDescription : NonemolecularWeight : 142.34...
Anti-Tau Reference Antibody (posdinemab)
Product Name : Anti-Tau Reference Antibody (posdinemab)synonym : null,productDescription : NonemolecularWeight : 145.52 kDaendotoxin...
Anti-Amyloid Beta Reference Antibody (Aβab002)
Product Name : Anti-Amyloid Beta Reference Antibody (Aβab002)synonym : null,productDescription : NonemolecularWeight : 147.06...
Anti-Amyloid Beta Reference Antibody (Aβab001)
Product Name : Anti-Amyloid Beta Reference Antibody (Aβab001)synonym : null,productDescription : NonemolecularWeight : 145.36...
Anti-TL1A Reference Antibody (PF-06480605)
Product Name : Anti-TL1A Reference Antibody (PF-06480605)synonym : productDescription : NonemolecularWeight : 146.54endotoxin :...
Anti-TL1A Reference Antibody (PR200，5C3D11)
Product Name : Anti-TL1A Reference Antibody (PR200，5C3D11)synonym : productDescription : NonemolecularWeight : 144.42endotoxin :...
Anti-MUC2 Mouse mAb
Product Name : Anti-MUC2 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 540endotoxin : Nonepurity...
Anti-MMAE
Product Name : Anti-MMAEsynonym : productDescription : NonemolecularWeight : 146.32 KDaendotoxin : ＜1 EU/mgpurity...
Anti-BSG2 / CD147 Reference Antibody (HcHAb18-DM1）
Product Name : Anti-BSG2 / CD147 Reference Antibody (HcHAb18-DM1）synonym : productDescription : NonemolecularWeight :...
Anti-TL1A Reference Antibody (PR200，1D1)
Product Name : Anti-TL1A Reference Antibody (PR200，1D1)synonym : productDescription : NonemolecularWeight : 144.26 kDaendotoxin...
Anti-CLDN18.2 Reference Antibody (zolbetuximab MMAE)
Product Name : Anti-CLDN18.2 Reference Antibody (zolbetuximab MMAE)synonym : productDescription : .Anti-CLDN18.2 Reference Antibody...
Anti-EGFR & Fc-gamma-RIIIA Reference Antibody (AFM24)
Product Name : Anti-EGFR & Fc-gamma-RIIIA Reference Antibody (AFM24)synonym : null,productDescription : Anti-EGFR &...
Anti-CD3 & EpCAM Reference Antibody (Catumaxomab(huIgG1-rat IgG2b))
Product Name : Anti-CD3 & EpCAM Reference Antibody (Catumaxomab(huIgG1-rat IgG2b))synonym : null,productDescription : Anti-CD3...
Anti-CD3 & EpCAM Reference Antibody (Catumaxomab(mIgG2a-rat IgG2b))
Product Name : Anti-CD3 & EpCAM Reference Antibody (Catumaxomab(mIgG2a-rat IgG2b))synonym : null,productDescription : Anti-CD3...
Anti-CD3 & FCRL5 Reference Antibody (Cevostamab)
Product Name : Anti-CD3 & FCRL5 Reference Antibody (Cevostamab)synonym : null,productDescription : Anti-CD3 &...
Anti-BAFF & IL-17A Reference Antibody (Tibulizumab)
Product Name : Anti-BAFF & IL-17A Reference Antibody (Tibulizumab)synonym : null,productDescription : Anti-BAFF &...
Anti-CD3 & CD20 Reference Antibody (Epcoritamab)
Product Name : Anti-CD3 & CD20 Reference Antibody (Epcoritamab)synonym : null,productDescription : Anti-CD3 &...
Anti-MSH6 Rabbit mAb
Product Name : Anti-MSH6 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 153endotoxin : Nonepurity...
Anti-CD3 & BCMA Reference Antibody (Teclistamab)
Product Name : Anti-CD3 & BCMA Reference Antibody (Teclistamab)synonym : null,productDescription : Anti-CD3 &...
Anti-CD123 & CD3 Reference Antibody (Flotetuzumab)
Product Name : Anti-CD123 & CD3 Reference Antibody (Flotetuzumab)synonym : null,productDescription : Anti-CD123 &...
Anti-GPRC5D & CD3 Reference Antibody (Talquetamab)
Product Name : Anti-GPRC5D & CD3 Reference Antibody (Talquetamab)synonym : null,productDescription : Anti-GPRC5D &...
Anti-IL-1a & IL1b Reference Antibody (Lutikizumab)
Product Name : Anti-IL-1a & IL1b Reference Antibody (Lutikizumab)synonym : null,productDescription : Anti-IL1a &...
Anti-TNFalpha & IL-17 Reference Antibody (ABT122)
Product Name : Anti-TNFalpha & IL-17 Reference Antibody (ABT122)synonym : null,productDescription : Anti-TNFalpha &...
Anti-ANG2 & VEGFA Reference Antibody (Vanucizumab)
Product Name : Anti-ANG2 & VEGFA Reference Antibody (Vanucizumab)synonym : null,productDescription : Anti-ANG2 &...
Anti-ANG2 & VEGFA Reference Antibody (Faricimab)
Product Name : Anti-ANG2 & VEGFA Reference Antibody (Faricimab)synonym : null,productDescription : Anti-ANG2 &...
Anti-CD137 & Her2 Reference Antibody (Cinrebafusp alfa)
Product Name : Anti-CD137 & Her2 Reference Antibody (Cinrebafusp alfa)synonym : null,productDescription : Anti-CD137...
Anti-LGR5 & EGFR Reference Antibody (Petosemtamab)
Product Name : Anti-LGR5 & EGFR Reference Antibody (Petosemtamab)synonym : null,productDescription : Anti-LGR5 &...
Anti-CanAg Reference Antibody (Cantuzumab)
Product Name : Anti-CanAg Reference Antibody (Cantuzumab)synonym : null,productDescription : Anti-CanAg Reference Antibody (Cantuzumab)(CHB363)...
Anti-MSH2 Rabbit mAb
Product Name : Anti-MSH2 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 105endotoxin : Nonepurity...
Anti-EpCAM / TROP1 / CD326 Mouse mAb
Product Name : Anti-EpCAM / TROP1 / CD326 Mouse mAbsynonym : null,productDescription : NonemolecularWeight...
Anti-ADAM9 Reference Antibody (Imgc936)
Product Name : Anti-ADAM9 Reference Antibody (Imgc936)synonym : null,productDescription : Anti-ADAM9 Reference Antibody (Imgc936)(CHA362)...
Anti-GPC2 / Glypican 2 Reference Antibody (Nih Patent Anti-Glypican-2)
Product Name : Anti-GPC2 / Glypican 2 Reference Antibody (Nih Patent Anti-Glypican-2)synonym : null,productDescription...
Anti-MAGE-A4 Reference Antibody (Imc-C103C)
Product Name : Anti-MAGE-A4 Reference Antibody (Imc-C103C)synonym : null,productDescription : Anti-MAGE-A4 Reference Antibody (Imc-C103C)(CHB360)...
Anti-NAMPT Reference Antibody (Alt-100)
Product Name : Anti-NAMPT Reference Antibody (Alt-100)synonym : null,productDescription : Anti-NAMPT Reference Antibody (Alt-100)(CHB359)...
Anti-CD93 Reference Antibody (Dcby02)
Product Name : Anti-CD93 Reference Antibody (Dcby02)synonym : null,productDescription : Anti-CD93 Reference Antibody (Dcby02)(CHB358)...
Anti-SEZ6 Reference Antibody (Abbv-011)
Product Name : Anti-SEZ6 Reference Antibody (Abbv-011)synonym : null,productDescription : Anti-SEZ6 Reference Antibody (Abbv-011)(CHB357)...
Anti-TREM2 Reference Antibody (PY314)
Product Name : Anti-TREM2 Reference Antibody (PY314)synonym : null,productDescription : Anti-TREM2 Reference Antibody (Py314)(CHB356)...
Anti-ALP Reference Antibody (Seagen Patent Anti-Alpp)
Product Name : Anti-ALP Reference Antibody (Seagen Patent Anti-Alpp)synonym : null,productDescription : Anti-ALP Reference...
Anti-SLC7A11 Reference Antibody (Agilvax Patent Anti-Slc7A11)
Product Name : Anti-SLC7A11 Reference Antibody (Agilvax Patent Anti-Slc7A11)synonym : null,productDescription : Anti-SLC7A11 Reference...
Anti-Meflin Reference Antibody (Tokai U. Patent Anti-Meflin)
Product Name : Anti-Meflin Reference Antibody (Tokai U. Patent Anti-Meflin)synonym : null,productDescription : Anti-Meflin...
Anti-MLH1 Rabbit mAb
Product Name : Anti-MLH1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 85endotoxin : Nonepurity...
Anti-CD36 Reference Antibody (Ona Thera Patent Anti-Cd36)
Product Name : Anti-CD36 Reference Antibody (Ona Thera Patent Anti-Cd36)synonym : null,productDescription : Anti-CD36...
Anti-CD98 Reference Antibody (Ign523)
Product Name : Anti-CD98 Reference Antibody (Ign523)synonym : null,productDescription : Anti-CD98 Reference Antibody (Ign523)(CHB351)...
Anti-PVR / CD155 Reference Antibody (Ntx1088)
Product Name : Anti-PVR / CD155 Reference Antibody (Ntx1088)synonym : null,productDescription : Anti-PVR /...
Anti-CDCP1 / CD318 Reference Antibody (38 E11)
Product Name : Anti-CDCP1 / CD318 Reference Antibody (38 E11)synonym : null,productDescription : Anti-CDCP1...
Anti-MSPR / RON / CD136 Reference Antibody (H5B14)
Product Name : Anti-MSPR / RON / CD136 Reference Antibody (H5B14)synonym : null,productDescription :...
Anti-Transferrin receptor / CD71 Reference Antibody (Jr-141)
Product Name : Anti-Transferrin receptor / CD71 Reference Antibody (Jr-141)synonym : null,productDescription : Anti-Transferrin...
Anti-Fc gamma R1 Reference Antibody (Medarex Patent Anti-Fc-Gamma-R1)
Product Name : Anti-Fc gamma R1 Reference Antibody (Medarex Patent Anti-Fc-Gamma-R1)synonym : null,productDescription :...
Anti-MRC2 / CD280 Reference Antibody (Quark Patent Anti-Endo180)
Product Name : Anti-MRC2 / CD280 Reference Antibody (Quark Patent Anti-Endo180)synonym : null,productDescription :...
Anti-ENPP3 / CD203c Reference Antibody (Ags-16C3F)
Product Name : Anti-ENPP3 / CD203c Reference Antibody (Ags-16C3F)synonym : null,productDescription : Anti-ENPP3 /...
Anti-TM4SF1 Reference Antibody (Beth Israel Patent Anti-TM4SF1)
Product Name : Anti-TM4SF1 Reference Antibody (Beth Israel Patent Anti-TM4SF1)synonym : null,productDescription : Anti-TM4SF1...
Anti-MART-1/melan A Mouse mAb
Product Name : Anti-MART-1/melan A Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 13endotoxin :...
Anti-ROR2 Reference Antibody (Ozuriftamab)
Product Name : Anti-ROR2 Reference Antibody (Ozuriftamab)synonym : null,productDescription : Anti-ROR2 Reference Antibody (Ozuriftamab)(CHB342)...
Anti-Siglec-3 / CD33 Reference Antibody (Gemtuzumab)
Product Name : Anti-Siglec-3 / CD33 Reference Antibody (Gemtuzumab)synonym : null,productDescription : Anti-Siglec-3 /...
Anti-TROP2 Reference Antibody (Datopotamab)
Product Name : Anti-TROP2 Reference Antibody (Datopotamab)synonym : null,productDescription : Anti-TROP2 Reference Antibody (Datopotamab)(CHB340)...
Anti-ERBB1 / EGFR / HER1 Reference Antibody (Serclutamab talirine)
Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (Serclutamab talirine)synonym : productDescription...
Anti-ERBB1 / EGFR / HER1 Reference Antibody (Laprituximab emtansine)
Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (Laprituximab emtansine)synonym : null,productDescription...
Anti-MUC16 Reference Antibody (Sofituzumab vedotin)
Product Name : Anti-MUC16 Reference Antibody (Sofituzumab vedotin)synonym : productDescription : Sofituzumab vedotin is...
Anti-SLITRK6 Reference Antibody (Sirtratumab vedotin)
Product Name : Anti-SLITRK6 Reference Antibody (Sirtratumab vedotin)synonym : null,productDescription : Sirtratumab vedotin is...
Anti-TNFSF7 / CD27L / CD70 Reference Antibody (Vorsetuzumab mafodotin)
Product Name : Anti-TNFSF7 / CD27L / CD70 Reference Antibody (Vorsetuzumab mafodotin)synonym : productDescription...
Anti-CD79b Reference Antibody (iladatuzumab vedotin)
Product Name : Anti-CD79b Reference Antibody (iladatuzumab vedotin)synonym : productDescription : iladatuzumab vedotin is...
Anti-CanAg Reference Antibody (Cantuzumab ravtansine)
Product Name : Anti-CanAg Reference Antibody (Cantuzumab ravtansine)synonym : null,productDescription : Cantuzumab ravtansine is...
Anti-Mammaglobin Mouse mAb
Product Name : Anti-Mammaglobin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 10endotoxin : Nonepurity...
Anti-CanAg Reference Antibody (Cantuzumab mertansine)
Product Name : Anti-CanAg Reference Antibody (Cantuzumab mertansine)synonym : null,productDescription : Cantuzumab mertansine is...
Anti-Siglec-3 / CD33 Reference Antibody (Gemtuzumab ozogamicin)
Product Name : Anti-Siglec-3 / CD33 Reference Antibody (Gemtuzumab ozogamicin)synonym : null,productDescription : Gemtuzumab...
Anti-CD19 Reference Antibody (Loncastuximab tesirine)
Product Name : Anti-CD19 Reference Antibody (Loncastuximab tesirine)synonym : null,productDescription : Loncastuximab tesirine is...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab duocarmazine)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab duocarmazine)synonym : null,productDescription...
Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab-MMAE)
Product Name : Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab-MMAE)synonym : null,productDescription : Anti-Siglec-2 /...
Anti-Siglec-3 / CD33 Reference Antibody (vadastuximab talirine)
Product Name : Anti-Siglec-3 / CD33 Reference Antibody (vadastuximab talirine)synonym : null,productDescription : Vadastuximab...
Anti-ERBB1 / EGFR / HER1 Reference Antibody (Cetuximab-MMAE)
Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (Cetuximab-MMAE)synonym : productDescription :...
Anti-ERBB3/ HER3 Reference Antibody (Patritumab deruxtecan)
Product Name : Anti-ERBB3/ HER3 Reference Antibody (Patritumab deruxtecan)synonym : productDescription : Anti-ERBB3/ HER3...
Anti-FOLR1 / FRA Reference Antibody (mirvetuximab-MMAE)
Product Name : Anti-FOLR1 / FRA Reference Antibody (mirvetuximab-MMAE)synonym : null,productDescription : Anti-FOLR1 Reference...
Anti-TROP2 Reference Antibody (Sacituzumab-MMAE)
Product Name : Anti-TROP2 Reference Antibody (Sacituzumab-MMAE)synonym : null,productDescription : Anti-TROP2 Reference Antibody (Sacituzumab-MMAE)(CHB295)...
Anti-LEF-1 Rabbit mAb
Product Name : Anti-LEF-1 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 44endotoxin : Nonepurity...
Anti-DLL3 Reference Antibody (rovalpituzumab-MMAE)
Product Name : Anti-DLL3 Reference Antibody (rovalpituzumab-MMAE)synonym : null,productDescription : Anti-DLL3 Reference Antibody (rovalpituzumab-MMAE)(CHB294)...
Anti-CA9 / CAIX Reference Antibody (girentuximab-MMAE)
Product Name : Anti-CA9 / CAIX Reference Antibody (girentuximab-MMAE)synonym : null,productDescription : Anti-CAIX Reference...
Anti-IL-3Ra / CD123 Reference Antibody (talacotuzumab-MMAE)
Product Name : Anti-IL-3Ra / CD123 Reference Antibody (talacotuzumab-MMAE)synonym : null,productDescription : Talacotuzumab-MMAE is...
Anti-MUC1 Reference Antibody (clivatuzumab-MMAE)
Product Name : Anti-MUC1 Reference Antibody (clivatuzumab-MMAE)synonym : productDescription : Clivatuzumab-MMAE is an ADC...
Anti-Endoglin / CD105 Reference Antibody (carotuximab-MMAE)
Product Name : Anti-Endoglin / CD105 Reference Antibody (carotuximab-MMAE)synonym : null,productDescription : Carotuximab-MMAE is...
Anti-AMHR2 Reference Antibody (Murlentamab-MMAE)
Product Name : Anti-AMHR2 Reference Antibody (Murlentamab-MMAE)synonym : productDescription : Murlentamab-MMAE is an ADC...
Anti-MU5AC Reference Antibody (ensituximab-MMAE)
Product Name : Anti-MU5AC Reference Antibody (ensituximab-MMAE)synonym : null,productDescription : Anti-MU5AC Reference Antibody (ensituximab-MMAE)(CHB288)...
Anti-GD3 Reference Antibody (ecromeximab-MMAE)
Product Name : Anti-GD3 Reference Antibody (ecromeximab-MMAE)synonym : null,productDescription : Anti-GD3 Reference Antibody (ecromeximab-MMAE)(CHB287)...
Anti-CXCR4/CD184 Reference Antibody (ulocuplumab-MMAE)
Product Name : Anti-CXCR4/CD184 Reference Antibody (ulocuplumab-MMAE)synonym : null,productDescription : Anti-CXCR4/CD184 Reference Antibody (ulocuplumab-MMAE)(CHB286)...
Anti-FOLR1 / FRA Reference Antibody (farletuzumab-MMAE)
Product Name : Anti-FOLR1 / FRA Reference Antibody (farletuzumab-MMAE)synonym : null,productDescription : Farletuzumab-MMAE is...
Anti-Langerin Rabbit mAb
Product Name : Anti-Langerin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 37endotoxin : Nonepurity...
Anti-FOLH1 / PSMA Reference Antibody (rosopatamab-MMAE)
Product Name : Anti-FOLH1 / PSMA Reference Antibody (rosopatamab-MMAE)synonym : null,productDescription : Rosopatamab-MMAE is...
Anti-FOLH1 / PSMA Reference Antibody (rosopatamab tetraxetan)
Product Name : Anti-FOLH1 / PSMA Reference Antibody (rosopatamab tetraxetan)synonym : null,productDescription : Rosopatamab...
Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab-MMAE)
Product Name : Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab-MMAE)synonym : null,productDescription : Lorvotuzumab-MMAE is...
Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab mertansine)
Product Name : Anti-NCAM1 / CD56 Reference Antibody (lorvotuzumab mertansine)synonym : null,productDescription : Lorvotuzumab...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab-MMAE)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab-MMAE)synonym : null,productDescription :...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab emtansine)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab emtansine)synonym : null,productDescription...
Anti-Mesothelin Reference Antibody (anetumab-MMAE)
Product Name : Anti-Mesothelin Reference Antibody (anetumab-MMAE)synonym : productDescription : Anetumab-MMAE is an ADC...
Anti-Mesothelin Reference Antibody (anetumab ravtansine)
Product Name : Anti-Mesothelin Reference Antibody (anetumab ravtansine)synonym : null,productDescription : Anetumab ravtansine is...
Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab-MMAE)
Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab-MMAE)synonym : productDescription :...
Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab ravtansine)
Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (Tusamitamab ravtansine)synonym : productDescription...
Anti-Lambda Mouse mAb
Product Name : Anti-Lambda Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 11endotoxin : Nonepurity...
Anti-ALCAM / CD166 Reference Antibody (Praluzatamab-MMAE)
Product Name : Anti-ALCAM / CD166 Reference Antibody (Praluzatamab-MMAE)synonym : productDescription : Praluzatamab-MMAE is...
Anti-ALCAM/CD166 Reference Antibody (praluzatamab ravtansine)
Product Name : Anti-ALCAM/CD166 Reference Antibody (praluzatamab ravtansine)synonym : null,productDescription : Praluzatamab ravtansine is...
Anti-FOLR1 / FRA Reference Antibody (Mirvetuximab soravtansine)
Product Name : Anti-FOLR1 / FRA Reference Antibody (Mirvetuximab soravtansine)synonym : productDescription : Mirvetuximab...
Anti-TROP2 Reference Antibody (datopotamab deruxtecan)
Product Name : Anti-TROP2 Reference Antibody (datopotamab deruxtecan)synonym : null,productDescription : Datopotamab deruxtecan is...
Anti-MUC16 Reference Antibody (oregovomab-MMAE)
Product Name : Anti-MUC16 Reference Antibody (oregovomab-MMAE)synonym : null,productDescription : Anti-MUC16 Reference Antibody (oregovomab-MMAE)(CHB269)...
Anti-ERBB3/ HER3 Reference Antibody (patritumab-MMAE)
Product Name : Anti-ERBB3/ HER3 Reference Antibody (patritumab-MMAE)synonym : null,productDescription : Anti-ERBB3/HER3 Reference Antibody...
Anti-ERBB1 / EGFR / HER1 Reference Antibody (depatuxizumab-MMAF)
Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (depatuxizumab-MMAF)synonym : productDescription :...
Anti-ROR1 Reference Antibody (Zilovertamab vedotin)
Product Name : Anti-ROR1 Reference Antibody (Zilovertamab vedotin)synonym : productDescription : zilovertamab vedotin is...
Anti-Siglec-2 / CD22 Reference Antibody (Pinatuzumab vedotin)
Product Name : Anti-Siglec-2 / CD22 Reference Antibody (Pinatuzumab vedotin)synonym : productDescription : Pinatuzumab...
Anti-ROR2 Reference Antibody (ozuriftamab vedotin)
Product Name : Anti-ROR2 Reference Antibody (ozuriftamab vedotin)synonym : productDescription : Ozuriftamab vedotin is...
Anti-Ksp Cadherin Rabbit mAb
Product Name : Anti-Ksp Cadherin Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 90endotoxin :...
Anti-NaPi2b / SLC34A2 Reference Antibody (Lifastuzumab vedotin)
Product Name : Anti-NaPi2b / SLC34A2 Reference Antibody (Lifastuzumab vedotin)synonym : productDescription : Lifastuzumab...
Anti-CEACAM5 / CEA / CD66e Reference Antibody (labetuzumab govitecan)
Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (labetuzumab govitecan)synonym : productDescription...
Anti-GUCY2C Reference Antibody (Indusatumab vedotin)
Product Name : Anti-GUCY2C Reference Antibody (Indusatumab vedotin)synonym : productDescription : Indusatumab vedotin is...
Anti-GPNMB Reference Antibody (Glembatumumab vedotin)
Product Name : Anti-GPNMB Reference Antibody (Glembatumumab vedotin)synonym : productDescription : Glembatumumab vedotin targets...
Anti-CD19 Reference Antibody (denintuzumab-MMAF)
Product Name : Anti-CD19 Reference Antibody (denintuzumab-MMAF)synonym : null,productDescription : Denintuzumab-MMAF is an ADC...
Anti-AXL / UFO Reference Antibody (Enapotamab vedotin)
Product Name : Anti-AXL / UFO Reference Antibody (Enapotamab vedotin)synonym : productDescription : Enapotamab...
Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (tisotumab vedotin)
Product Name : Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody...
Anti-CD79b Reference Antibody (Polatuzumab vedotin-piiq)
Product Name : Anti-CD79b Reference Antibody (Polatuzumab vedotin-piiq)synonym : productDescription : Polatuzumab vedotin (Polivy)...
Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab-CLM)
Product Name : Anti-Siglec-2 / CD22 Reference Antibody (inotuzumab-CLM)synonym : null,productDescription : Anti-Siglec-2 /...
Anti-Siglec-3 / CD33 Reference Antibody (gemtuzumab-CLM)
Product Name : Anti-Siglec-3 / CD33 Reference Antibody (gemtuzumab-CLM)synonym : null,productDescription : Anti-Siglec-3 /...
Anti-Ki-67 Rabbit mAb
Product Name : Anti-Ki-67 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 359endotoxin : Nonepurity...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (Disitamab vedotin)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (Disitamab vedotin)synonym : productDescription...
Anti-TNFRSF8 / CD30 Reference Antibody (brentuximab vedotin)
Product Name : Anti-TNFRSF8 / CD30 Reference Antibody (brentuximab vedotin)synonym : productDescription : Brentuximab...
Anti-TNFRSF17 / BCMA / CD269 Reference Antibody (belantamab mafodotin)
Product Name : Anti-TNFRSF17 / BCMA / CD269 Reference Antibody (belantamab mafodotin)synonym : null,productDescription...
Anti-LIV-1 / SLC39A6 Reference Antibody (Ladiratuzumab vedotin)
Product Name : Anti-LIV-1 / SLC39A6 Reference Antibody (Ladiratuzumab vedotin)synonym : productDescription : Ladiratuzumab...
Anti-HGFR / c-Met Reference Antibody (Telisotuzumab vedotin)
Product Name : Anti-HGFR / c-Met Reference Antibody (Telisotuzumab vedotin)synonym : productDescription : Telisotuzumab...
Anti-Nectin-4 Reference Antibody (enfortumab vedotin-ejfv)
Product Name : Anti-Nectin-4 Reference Antibody (enfortumab vedotin-ejfv)synonym : productDescription : Enfortumab vedotin-ejfv is...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab deruxtecan)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (Trastuzumab deruxtecan)synonym : productDescription...
Anti-CLDN6 Reference Antibody (AB1-11)
Product Name : Anti-CLDN6 Reference Antibody (AB1-11)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (AB1-11)...
Anti-CLDN6 Reference Antibody (AB3-7)
Product Name : Anti-CLDN6 Reference Antibody (AB3-7)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (AB3-7)...
Anti-CLDN6 Reference Antibody (64A)
Product Name : Anti-CLDN6 Reference Antibody (64A)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (64A)...
Anti-Kappa Rabbit mAb
Product Name : Anti-Kappa Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 12endotoxin : Nonepurity...
Anti-CLDN6 Reference Antibody (AE3-20)
Product Name : Anti-CLDN6 Reference Antibody (AE3-20)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (AE3-20)...
Anti-CLDN6 Reference Antibody (DS-9606a)
Product Name : Anti-CLDN6 Reference Antibody (DS-9606a)synonym : null,productDescription : Anti-CLDN6 Reference Antibody (DS-9606a)...
Anti-CDH17 / Cadherin-17 Reference Antibody (PTA001_A4)
Product Name : Anti-CDH17 / Cadherin-17 Reference Antibody (PTA001_A4)synonym : null,productDescription : Anti-CDH17 /...
Anti-CDH17 / Cadherin-17 Reference Antibody (10C12)
Product Name : Anti-CDH17 / Cadherin-17 Reference Antibody (10C12)synonym : null,productDescription : Anti-CDH17 /...
Anti-SIRPa / CD172a Reference Antibody (BI 765063)
Product Name : Anti-SIRPa / CD172a Reference Antibody (BI 765063)synonym : null,productDescription : Anti-SIRPa...
Anti-AXL / UFO Reference Antibody (Tilvestamab-MMAE)
Product Name : Anti-AXL / UFO Reference Antibody (Tilvestamab-MMAE)synonym : null,productDescription : Tilvestamab-MMAE is...
Anti-KAAG1 Reference Antibody (ADCT-901-MMAE)
Product Name : Anti-KAAG1 Reference Antibody (ADCT-901-MMAE)synonym : null,productDescription : Anti-KAAG1 Reference Antibody (ADCT-901-MMAE)(CHB238)...
Anti-TROP2 Reference Antibody (Sacituzumab govitecan)
Product Name : Anti-TROP2 Reference Antibody (Sacituzumab govitecan)synonym : productDescription : Sacituzumab govitecan is...
Anti-GPC3 / Glypican-3 Reference Antibody (Codrituzumab-MMAE)
Product Name : Anti-GPC3 / Glypican-3 Reference Antibody (Codrituzumab-MMAE)synonym : productDescription : Codrituzumab-MMAE is...
Anti-BTN1A1 Reference Antibody (ICT-01-N297A)
Product Name : Anti-BTN1A1 Reference Antibody (ICT-01-N297A)synonym : null,productDescription : Anti-BTN1A1 Reference Antibody (ICT-01-N297A)(CHB222)...
Anti-Insulin Mouse mAb
Product Name : Anti-Insulin Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 12endotoxin : Nonepurity...
Anti-Bax Rabbit mAb
Product Name : Anti-Bax Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 21 kDaendotoxin :...
Anti-BTN1A1 Reference Antibody (ICT-01)
Product Name : Anti-BTN1A1 Reference Antibody (ICT-01)synonym : null,productDescription : Anti-BTN1A1 Reference Antibody (ICT-01)(CHB221)...
Anti-AA2AR / Adenosine A2aR Reference Antibody (3F6-9G5)
Product Name : Anti-AA2AR / Adenosine A2aR Reference Antibody (3F6-9G5)synonym : null,productDescription : Anti-AA2AR...
Molecular-cancer/content/12/1/Page 15 of200 M, then incubated for 1 h at 37 in
Molecular-cancer/content/12/1/Page 15 of200 M, then incubated for 1 h at 37 in culture medium...
Etastasis of breast cancer cells by way of activating mTORC2/Akt/FOXO3a
Etastasis of breast cancer cells by means of activating mTORC2/Akt/FOXO3a signaling pathway. Cell Death....
Otypic variations. As opposed to genetic modifications of cell populations, there was small
Otypic differences. In contrast to genetic modifications of cell populations, there was little time...
Anti-TPBG Reference Antibody (ASN004)
Product Name : Anti-TPBG Reference Antibody (ASN004)synonym : null,productDescription : Anti-TPBG Reference Antibody (ASN004)...
Anti-TSLP Reference Antibody (tezepelumab)
Product Name : Anti-TSLP Reference Antibody (tezepelumab)synonym : null,productDescription : Anti-TSLP Reference Antibody (tezepelumab)(CHB216)...
Anti-TGFb1 Reference Antibody (Genzyme patent anti-TGF-β)
Product Name : Anti-TGFb1 Reference Antibody (Genzyme patent anti-TGF-β)synonym : null,productDescription : Anti-TGFb1 Reference...
Anti-CD19 Reference Antibody (obexelimab)
Product Name : Anti-CD19 Reference Antibody (obexelimab)synonym : null,productDescription : Anti-CD19 Reference Antibody (obexelimab)(CHB213)...
Anti-IFNAR1 Reference Antibody (Medarex patent anti-IFNAR-1)
Product Name : Anti-IFNAR1 Reference Antibody (Medarex patent anti-IFNAR-1)synonym : null,productDescription : Anti-IFNAR1 Reference...
Anti-GD2 Reference Antibody (naxitamab)
Product Name : Anti-GD2 Reference Antibody (naxitamab)synonym : null,productDescription : Anti-GD2 Reference Antibody (naxitamab)(CHB210)...
Anti-CEACAM5 / CEA / CD66e Reference Antibody (Immunomedics patent anti-CEACAM5 (Class III))
Product Name : Anti-CEACAM5 / CEA / CD66e Reference Antibody (Immunomedics patent anti-CEACAM5 (Class...
Anti-CSF1R / M-CSFR / CD115 Reference Antibody (axatilimab)
Product Name : Anti-CSF1R / M-CSFR / CD115 Reference Antibody (axatilimab)synonym : null,productDescription :...
Anti-INHAMouse mAb
Product Name : Anti-INHAMouse mAbsynonym : null,productDescription : NonemolecularWeight : 40endotoxin : Nonepurity :...
Anti-GLP1R Reference Antibody (Centocor patent anti-GLP-1R)
Product Name : Anti-GLP1R Reference Antibody (Centocor patent anti-GLP-1R)synonym : null,productDescription : Anti-GLP1R Reference...
N-acetylation needed for ERAD-L|We conclude that N-terminal acetylation of Der
N-acetylation necessary for ERAD-L|We conclude that N-terminal acetylation of Der1, even though crucial for...
In animals on both typical salt and high salt diets (21, 22). The
In animals on each standard salt and higher salt diets (21, 22). The sturdy...
Confident, a forward selection process is employed exactly where essentially the most considerable
Confident, a forward selection procedure is employed where one of the most significant association...
Anti-VEGF Reference Antibody (BioMab patent anti-VEGF)
Product Name : Anti-VEGF Reference Antibody (BioMab patent anti-VEGF)synonym : null,productDescription : Anti-VEGF Reference...
Anti-ERBB2 / HER2 / CD340 Reference Antibody (BioMab patent anti-Her2)
Product Name : Anti-ERBB2 / HER2 / CD340 Reference Antibody (BioMab patent anti-Her2)synonym :...
Anti-CTLA-4 / CD152 Reference Antibody (Antitope patent anti-CTLA4)
Product Name : Anti-CTLA-4 / CD152 Reference Antibody (Antitope patent anti-CTLA4)synonym : null,productDescription :...
Anti-Amyloid Beta Reference Antibody (lecanemab)
Product Name : Anti-Amyloid Beta Reference Antibody (lecanemab)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Anti-Amyloid Beta Reference Antibody (bapineuzumab)
Product Name : Anti-Amyloid Beta Reference Antibody (bapineuzumab)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Anti-VEGFR3 / FLT4 Reference Antibody (LY3022856)
Product Name : Anti-VEGFR3 / FLT4 Reference Antibody (LY3022856)synonym : null,productDescription : Anti-VEGFR3 /...
Anti-VEGFR2 / KDR / CD309 Reference Antibody (vulinacimab)
Product Name : Anti-VEGFR2 / KDR / CD309 Reference Antibody (vulinacimab)synonym : null,productDescription :...
Anti-VEGFR2 / KDR / CD309 Reference Antibody (AT001)
Product Name : Anti-VEGFR2 / KDR / CD309 Reference Antibody (AT001)synonym : null,productDescription :...
Anti-VEGFR2 / KDR / CD309 Reference Antibody (alacizumAb)
Product Name : Anti-VEGFR2 / KDR / CD309 Reference Antibody (alacizumAb)synonym : null,productDescription :...
Anti-IMP3 Rabbit mAb
Product Name : Anti-IMP3 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 22endotoxin : Nonepurity...
| www.plosone.orgtions, 240 mg/ml FPKc brought on 65.2062.34 cell viability loss, suggesting
| www.plosone.orgtions, 240 mg/ml FPKc triggered 65.2062.34 cell viability loss, suggesting some other cytotoxic...
Ites, and traumatic wounds. Arterial, venous, and diabetic leg ulcers Pressure
Ites, and traumatic wounds. Arterial, venous, and diabetic leg ulcers Stress ulcers, post-operative wounds,...
Anti-VEGFC Reference Antibody (VGX100)
Product Name : Anti-VEGFC Reference Antibody (VGX100)synonym : null,productDescription : Anti-VEGFC Reference Antibody (VGX100)(CHB195)...
Anti-VEGFA Reference Antibody (varisacumab)
Product Name : Anti-VEGFA Reference Antibody (varisacumab)synonym : null,productDescription : Anti-VEGFA Reference Antibody (varisacumab)(CHB194)...
Anti-VEGFA Reference Antibody (ranibizumab)
Product Name : Anti-VEGFA Reference Antibody (ranibizumab)synonym : null,productDescription : Anti-VEGFA Reference Antibody (ranibizumab)(CHB193)...
Anti-Tau Reference Antibody (zagotenemab)
Product Name : Anti-Tau Reference Antibody (zagotenemab)synonym : null,productDescription : Anti-Tau Reference Antibody (zagotenemab)(CHB191)...
Anti-VCAM1 / CD106 Reference Antibody (Hanwha patent anti-VCAM-1)
Product Name : Anti-VCAM1 / CD106 Reference Antibody (Hanwha patent anti-VCAM-1)synonym : productDescription :...
Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (vonlerizumab)
Product Name : Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (vonlerizumab)synonym : null,productDescription :...
Anti-Integrin a5b1 (ITGA5 & ITGB1) Reference Antibody (volociximab)
Product Name : Anti-Integrin a5b1 (ITGA5 & ITGB1) Reference Antibody (volociximab)synonym : null,productDescription :...
Anti-TSPAN26 / CD37 Reference Antibody (AGS67E)
Product Name : Anti-TSPAN26 / CD37 Reference Antibody (AGS67E)synonym : null,productDescription : Anti-TSPAN26 /...
Anti-TSLP Reference Antibody (Schering patent anti-TSLP)
Product Name : Anti-TSLP Reference Antibody (Schering patent anti-TSLP)synonym : null,productDescription : Anti-TSLP Reference...
Anti-TrkB / NTRK2 Reference Antibody (Rinat patent anti-TrkB)
Product Name : Anti-TrkB / NTRK2 Reference Antibody (Rinat patent anti-TrkB)synonym : null,productDescription :...
Sons largely agree involving estimates determined by OGs and those determined
Sons largely agree amongst estimates depending on OGs and these determined according to the...
Ggest that endogenous AA is usually a mediator advertising hypoxic vasoconstriction in
Ggest that endogenous AA is often a mediator promoting hypoxic vasoconstriction in the rat...
. 27. Boivin G, Lips P, Ott SM, et al. Contribution of raloxifene
. 27. Boivin G, Lips P, Ott SM, et al. Contribution of raloxifene and...
Preclinical model on which cellular therapy for X-linked SCID was created
Preclinical model on which cellular therapy for X-linked SCID was created and successfully translated...
Assay, ARR18 induced an ARR5:LUC construct by about 50 inside the
Assay, ARR18 induced an ARR5:LUC construct by about 50 in the presence of cytokinin...
(Miceli et al., 2009), we decided to investigate whether or not the P574S
(Miceli et al., 2009), we decided to investigate irrespective of whether the P574S mutation...
Anti-IgM Mouse mAb
Product Name : Anti-IgM Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 49endotoxin : Nonepurity...
Anti-TPBG Reference Antibody (Wyeth patent anti-5T4)
Product Name : Anti-TPBG Reference Antibody (Wyeth patent anti-5T4)synonym : null,productDescription : Anti-TPBG Reference...
Anti-Complement C5 Reference Antibody (vilobelimab)
Product Name : Anti-Complement C5 Reference Antibody (vilobelimab)synonym : null,productDescription : Anti-Complement C5 Reference...
Anti-TIGIT Reference Antibody (vibostolimab)
Product Name : Anti-TIGIT Reference Antibody (vibostolimab)synonym : null,productDescription : Anti-TIGIT Reference Antibody (vibostolimab)(CHB182)...
Anti-TNFSF5 / CD40L / CD154 Reference Antibody (ruplizumab)
Product Name : Anti-TNFSF5 / CD40L / CD154 Reference Antibody (ruplizumab)synonym : null,productDescription :...
Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (vedolizumab)
Product Name : Anti-Integrin a4b7 (ITGA4 & ITGB7) Reference Antibody (vedolizumab)synonym : null,productDescription :...
Anti-STEAP1 Reference Antibody (vandortuzumAb)
Product Name : Anti-STEAP1 Reference Antibody (vandortuzumAb)synonym : null,productDescription : Anti-STEAP1 Reference Antibody (vandortuzumAb)(CHB175)...
Anti-TNFSF2 / TNFa Reference Antibody (hMAK195)
Product Name : Anti-TNFSF2 / TNFa Reference Antibody (hMAK195)synonym : null,productDescription : Anti-TNFSF2 /...
Anti-TNFSF2 / TNFa Reference Antibody (ESBA 105)
Product Name : Anti-TNFSF2 / TNFa Reference Antibody (ESBA 105)synonym : null,productDescription : Anti-TNFSF2...
Anti-TNFSF2 / TNFa Reference Antibody (CMAB008)
Product Name : Anti-TNFSF2 / TNFa Reference Antibody (CMAB008)synonym : null,productDescription : Anti-TNFSF2 /...
Lls have been cultured and cell lysates have been prepared for immunoblotting or
Lls had been cultured and cell lysates have been prepared for immunoblotting or immunoprecipitation...
Enterococcus) were absent or in low abundance (i.e., , 1 of culturable
Enterococcus) had been absent or in low abundance (i.e., , 1 of culturable bacteria)....
OnedFigure 12. 7KCh induces crucial ER tension markers and SA inhibits this
OnedFigure 12. 7KCh induces important ER pressure markers and SA inhibits this response. ARPE19...
Velocity and amplitude (Bhat et al., 2001). These electrophysiological modifications are observed
Velocity and amplitude (Bhat et al., 2001). These electrophysiological adjustments are observed in all...
S, respectively ( p 0.0001, Fig 1A and B, and Supporting Information and facts Fig
S, respectively ( p 0.0001, Fig 1A and B, and Supporting Details Fig S1)....
Anti-Amyloid Beta Reference Antibody (U.Zurich patent anti-Amyloid Beta)
Product Name : Anti-Amyloid Beta Reference Antibody (U.Zurich patent anti-Amyloid Beta)synonym : null,productDescription :...
Anti-IgG4 Rabbit mAb
Product Name : Anti-IgG4 Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 36endotoxin : Nonepurity...
Anti-TNFSF2 / TNFa Reference Antibody (CDP571)
Product Name : Anti-TNFSF2 / TNFa Reference Antibody (CDP571)synonym : null,productDescription : Anti-TNFSF2 /...
Anti-TNFSF14 / LIGHT / CD258 Reference Antibody (SAR252067)
Product Name : Anti-TNFSF14 / LIGHT / CD258 Reference Antibody (SAR252067)synonym : null,productDescription :...
Anti-TNFSF13B / BAFF / CD257 Reference Antibody (tabalumab)
Product Name : Anti-TNFSF13B / BAFF / CD257 Reference Antibody (tabalumab)synonym : null,productDescription :...
Anti-TNFSF13 / APRIL / CD256 Reference Antibody (sibeprenlimab)
Product Name : Anti-TNFSF13 / APRIL / CD256 Reference Antibody (sibeprenlimab)synonym : null,productDescription :...
Anti-MICB Reference Antibody (U.Washington patent anti-MICB)
Product Name : Anti-MICB Reference Antibody (U.Washington patent anti-MICB)synonym : null,productDescription : Anti-MICB Reference...
Anti-GAD65 Reference Antibody (U.Washington patent anti-GAD65)
Product Name : Anti-GAD65 Reference Antibody (U.Washington patent anti-GAD65)synonym : null,productDescription : Anti-GAD65 Reference...
Anti-TNFSF1 / TNFb Reference Antibody (pateclizumab)
Product Name : Anti-TNFSF1 / TNFb Reference Antibody (pateclizumab)synonym : null,productDescription : Anti-TNFSF1 /...
Anti-DCSTAMP Reference Antibody (U.Rochester patent anti-DC-STAMP)
Product Name : Anti-DCSTAMP Reference Antibody (U.Rochester patent anti-DC-STAMP)synonym : null,productDescription : Anti-DCSTAMP Reference...
Ints and stored in RNAlater (Invitrogen AM7020) for 24 h at four (for
Ints and stored in RNAlater (Invitrogen AM7020) for 24 h at four (for RNA...
Lishment of latent infection, gene expression is limited to a gene
Lishment of latent infection, gene expression is limited to a gene situated within the...
Th TBSTween 0.1 and incubated using the acceptable horseradish peroxidase conjugated secondary
Th TBSTween 0.1 and incubated with the appropriate horseradish peroxidase conjugated secondary antibody, followed...
Ein bindJOURNAL OF BIOLOGICAL CHEMISTRYEXPERIMENTAL PROCEDURES Cells and Reagents–THP-1 (National Centre
Ein bindJOURNAL OF BIOLOGICAL CHEMISTRYEXPERIMENTAL PROCEDURES Cells and Reagents–THP-1 (National Centre for Cell Science...
LsonPagemeasurement noise in the CFSE information [241]. Fitting the model to T
LsonPagemeasurement noise inside the CFSE data . Fitting the model to T cell proliferation...
Levels within the perinatal period, substantially increasing the preterm infant’s
Levels within the perinatal period, considerably escalating the preterm infant’s risk of building invasive...
Anti-TNFRSF5 / CD40 Reference Antibody (ravagalimab)
Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (ravagalimab)synonym : null,productDescription : Anti-TNFRSF5 /...
Anti-TNFRSF5 / CD40 Reference Antibody (mitazalimab)
Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (mitazalimab)synonym : null,productDescription : Anti-TNFRSF5 /...
Anti-IgG Mouse mAb
Product Name : Anti-IgG Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 36endotoxin : Nonepurity...
Anti-TNFRSF5 / CD40 Reference Antibody (lucatumumab)
Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (lucatumumab)synonym : null,productDescription : Anti-TNFRSF5 /...
Anti-TNFRSF5 / CD40 Reference Antibody (iscalimab)
Product Name : Anti-TNFRSF5 / CD40 Reference Antibody (iscalimab)synonym : null,productDescription : Anti-TNFRSF5 /...
Anti-Amyloid Beta Reference Antibody (U.Illinois scFv59)
Product Name : Anti-Amyloid Beta Reference Antibody (U.Illinois scFv59)synonym : null,productDescription : Anti-Amyloid Beta...
Anti-IL-33 Reference Antibody (tozorakimab)
Product Name : Anti-IL-33 Reference Antibody (tozorakimab)synonym : null,productDescription : Anti-IL-33 Reference Antibody (tozorakimab)(CHB149)...
Anti-IL-33 Reference Antibody (torudokimab)
Product Name : Anti-IL-33 Reference Antibody (torudokimab)synonym : null,productDescription : Anti-IL-33 Reference Antibody (torudokimab)(CHB148)...
Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (BMS-986178)
Product Name : Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (BMS-986178)synonym : null,productDescription :...
Anti-PDCD1 / PD-1 / CD279 Reference Antibody (toripalimab)
Product Name : Anti-PDCD1 / PD-1 / CD279 Reference Antibody (toripalimab)synonym : null,productDescription :...
To a reaction mixture containing 20 M of phenol red (sodium salt
To a reaction mixture containing 20 M of phenol red (sodium salt), 1mM H2O2...
Sport proteins whose expression is regulated by numerous environmental stimuli. They
Sport proteins whose expression is regulated by numerous environmental stimuli. They underline the requirement...
Ogens typically resulting from inherent genetic difficulties, Niacin deficiency on the
Ogens typically on account of inherent genetic issues, Niacin deficiency on the other hand...
Mpler (Chemical Data Systems, Oxford, PA, USA) attached to a PerkinElmer
Mpler (Chemical Information Systems, Oxford, PA, USA) attached to a PerkinElmer GC/MS apparatus (Clarus...
Sidue within the equivalent position to Arg203. (MLK3 numbering) This group
Sidue within the equivalent position to Arg203. (MLK3 numbering) This group was recognized inside...
Hanks buffer eliminate unbound mAbs and incubated on ice with 1 : 1000 dilution
Hanks buffer remove unbound mAbs and incubated on ice with 1 : 1000 dilution...
Anti-CAPRIN1 Reference Antibody (Toray patent anti-Caprin-1)
Product Name : Anti-CAPRIN1 Reference Antibody (Toray patent anti-Caprin-1)synonym : null,productDescription : Anti-CAPRIN1 Reference...
Anti-ERBB1 / EGFR / HER1 Reference Antibody (tomuzotuximab)
Product Name : Anti-ERBB1 / EGFR / HER1 Reference Antibody (tomuzotuximab)synonym : null,productDescription :...
Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (lexatumumab)
Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (lexatumumab)synonym : null,productDescription :...
Anti-IgD Mouse mAb
Product Name : Anti-IgD Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 42endotoxin : Nonepurity...
Anti-TCR Reference Antibody (TOL101)
Product Name : Anti-TCR Reference Antibody (TOL101)synonym : null,productDescription : Anti-TCR Reference Antibody (TOL101)(CHB139)...
Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (benufutamab)
Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (benufutamab)synonym : null,productDescription :...
Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (TNX-832)
Product Name : Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody...
Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (tilogotamab)
Product Name : Anti-TNFRSF10B / TRAILR2 / CD262 Reference Antibody (tilogotamab)synonym : null,productDescription :...
Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody (Chugai patent anti-TF)
Product Name : Anti-TF / Factor III / Tissue Factor / CD142 Reference Antibody...
Anti-Tau Reference Antibody (tilavonemab)
Product Name : Anti-Tau Reference Antibody (tilavonemab)synonym : null,productDescription : Anti-Tau Reference Antibody (tilavonemab)(CHB133)...
Disruption by means of tight junction translocation and cytoskeletal reorganization inside the human
Disruption by way of tight junction translocation and cytoskeletal reorganization in the human bronchial...
N enhanced risk of building subsequent autoimmune ailments (rheumatoid arthritis, multiple
N enhanced danger of establishing subsequent autoimmune diseases (rheumatoid arthritis, a number of sclerosis,...
Man renal cell carcinoma [24], and glioblastomas [17]. RPLPO and TBP also belonged
Man renal cell carcinoma , and glioblastomas . RPLPO and TBP also belonged to...
Ernally located polyester that is certainly becoming cleaved by the enzyme could
Ernally located polyester that is certainly being cleaved by the enzyme might reside in...
F8300DsarA and SF8300DsaeRS. Transcripts of each psma and RNAIII
F8300DsarA and SF8300DsaeRS. Transcripts of each psma and RNAIII wereAlpha-type PSMs are Needed for...
Anti-CSF2 / GM-CSF Reference Antibody (Theraclone patent anti-GM-CSF)
Product Name : Anti-CSF2 / GM-CSF Reference Antibody (Theraclone patent anti-GM-CSF)synonym : null,productDescription :...
Anti-Complement C5 Reference Antibody (tesidolumab)
Product Name : Anti-Complement C5 Reference Antibody (tesidolumab)synonym : null,productDescription : Anti-Complement C5 Reference...
Anti-TIGIT Reference Antibody (etigilimab)
Product Name : Anti-TIGIT Reference Antibody (etigilimab)synonym : null,productDescription : Anti-TIGIT Reference Antibody (etigilimab)(CHB129)...
Anti-TGM2 / Transglutaminase 2 Reference Antibody (zampilimab)
Product Name : Anti-TGM2 / Transglutaminase 2 Reference Antibody (zampilimab)synonym : null,productDescription : Anti-TGM2...
Anti-IDH-1 Mouse mAb
Product Name : Anti-IDH-1 Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 47endotoxin : Nonepurity...
Anti-TGFb1 Reference Antibody (NIS793)
Product Name : Anti-TGFb1 Reference Antibody (NIS793)synonym : null,productDescription : Anti-TGFb1 Reference Antibody (NIS793)(CHB126)...
Anti-TFPI Reference Antibody (marstacimab)
Product Name : Anti-TFPI Reference Antibody (marstacimab)synonym : null,productDescription : Anti-TFPI Reference Antibody (marstacimab)(CHB124)...
Anti-Tenascin C Reference Antibody (tenatumomab)
Product Name : Anti-Tenascin C Reference Antibody (tenatumomab)synonym : null,productDescription : Anti-Tenascin C Reference...
Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (telazorlimab)
Product Name : Anti-TNFRSF4 / OX40 / CD134 Reference Antibody (telazorlimab)synonym : null,productDescription :...
Anti-TCR Reference Antibody (NKTT320)
Product Name : Anti-TCR Reference Antibody (NKTT320)synonym : null,productDescription : Anti-TCR Reference Antibody (NKTT320)(CHB118)...
Answer (SK-5300, Vector Blue). They had been then incubated having a rabbit
Remedy (SK-5300, Vector Blue). They had been then incubated using a rabbit anti-active caspase-3...
Ce, a situation that impairs voltage control. To overcome this trouble
Ce, a situation that impairs voltage control. To overcome this problem, we applied an...
D DNA synthesis by blocking uridine transport, therefore, inhibiting the pyrimidine
D DNA synthesis by blocking uridine transport, as a result, inhibiting the pyrimidine salvage...
Of HIC in any purification procedure presents two main challenges. In
Of HIC in any purification method presents two primary challenges. Generally, binding capacity has...
Ophobic and charged residues could mediate the NLRP3 inflammasome assembly (28). Could
Ophobic and charged residues may mediate the NLRP3 inflammasome assembly (28). Could these AIM2-specific...
Nin-8 (CCK-8) (Degorter et al., 2012), suggesting that these amino acids are
Nin-8 (CCK-8) (Degorter et al., 2012), suggesting that these amino acids are certainly involved...
Anti-TBFbR2 Reference Antibody (LY3022859)
Product Name : Anti-TBFbR2 Reference Antibody (LY3022859)synonym : null,productDescription : Anti-TBFbR2 Reference Antibody (LY3022859)(CHB117)...
Anti-PCSK9 Reference Antibody (tafolecimab)
Product Name : Anti-PCSK9 Reference Antibody (tafolecimab)synonym : null,productDescription : Anti-PCSK9 Reference Antibody (tafolecimab)(CHB115)...
Anti-Tau Reference Antibody (bepranemab)
Product Name : Anti-Tau Reference Antibody (bepranemab)synonym : null,productDescription : Anti-Tau Reference Antibody (bepranemab)(CHB113)...
Anti-Integrin a2b3 (ITGA2 & ITGB3) Reference Antibody (tadocizumab)
Product Name : Anti-Integrin a2b3 (ITGA2 & ITGB3) Reference Antibody (tadocizumab)synonym : null,productDescription :...
Anti-Sphingosine-1-phosphate Reference Antibody (sonepcizumab)
Product Name : Anti-Sphingosine-1-phosphate Reference Antibody (sonepcizumab)synonym : null,productDescription : Anti-Sphingosine-1-phosphate Reference Antibody (sonepcizumab)(CHB110)...
Anti-HSA Mouse mAb
Product Name : Anti-HSA Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 49endotoxin : Nonepurity...
Anti-Amyloid Beta Reference Antibody (solanezumab)
Product Name : Anti-Amyloid Beta Reference Antibody (solanezumab)synonym : null,productDescription : Anti-Amyloid Beta Reference...
Anti-NaPi2b / SLC34A2 Reference Antibody (upifitamab)
Product Name : Anti-NaPi2b / SLC34A2 Reference Antibody (upifitamab)synonym : null,productDescription : Anti-SLC34A2 Reference...
Anti-SLC2A8 Reference Antibody (VB1-050)
Product Name : Anti-SLC2A8 Reference Antibody (VB1-050)synonym : null,productDescription : Anti-SLC2A8 Reference Antibody (VB1-050)(CHB104)...
Anti-SLAMF7 / CS1 Reference Antibody (PDL241)
Product Name : Anti-SLAMF7 / CS1 Reference Antibody (PDL241)synonym : null,productDescription : Anti-SLAMF7 /...
The anti-tumor activity of 5-FU by apoptosis, inhibition of proliferation and
The anti-tumor activity of 5-FU by apoptosis, inhibition of proliferation and colony formation of...
Ss could result in Fas-mediated apoptosis. Nonetheless, the JNK pathway is
Ss could lead to Fas-mediated apoptosis. Nevertheless, the JNK pathway can also be involved...
Tively impacts cardiac glucose uptake and insulin sensitivity following ischemic injury
Tively impacts cardiac glucose uptake and insulin sensitivity following ischemic injury and eventually results...
Mann et al., 2012) were decrease than reported in previous studies. Two
Mann et al., 2012) have been decrease than reported in preceding studies. Two of...
Onds sustaining the structures of your ECD linker domain along with the
Onds sustaining the structures with the ECD linker domain plus the ECLs within the...
G of sodium citrate in 1000 mL of DEPC-treated water. paraformaldehyde (PFA
G of sodium citrate in 1000 mL of DEPC-treated water. paraformaldehyde (PFA) for 15...
Anti-SLAMF7 / CS1 Reference Antibody (azintuxizumAb)
Product Name : Anti-SLAMF7 / CS1 Reference Antibody (azintuxizumAb)synonym : null,productDescription : Anti-SLAMF7 /...
Anti-Siglec-3 / CD33 Reference Antibody (IMGN779)
Product Name : Anti-Siglec-3 / CD33 Reference Antibody (IMGN779)synonym : null,productDescription : Anti-Siglec-3 /...
Anti-Siglec-2 / CD22 Reference Antibody (pinatuzumab)
Product Name : Anti-Siglec-2 / CD22 Reference Antibody (pinatuzumab)synonym : null,productDescription : Anti-Siglec-2 /...
Anti-Siglec-2 / CD22 Reference Antibody (NCI m972)
Product Name : Anti-Siglec-2 / CD22 Reference Antibody (NCI m972)synonym : null,productDescription : Anti-Siglec-2...
Anti-Siglec-2 / CD22 Reference Antibody (NCI m971)
Product Name : Anti-Siglec-2 / CD22 Reference Antibody (NCI m971)synonym : null,productDescription : Anti-Siglec-2...
Anti-Siglec-2 / CD22 Reference Antibody (epratuzumab)
Product Name : Anti-Siglec-2 / CD22 Reference Antibody (epratuzumab)synonym : null,productDescription : Anti-Siglec-2 /...
Anti-HNF1 Beta Rabbit mAb
Product Name : Anti-HNF1 Beta Rabbit mAbsynonym : null,productDescription : NonemolecularWeight : 61endotoxin :...
Anti-Siglec-15 / CD33L3 Reference Antibody (Medimmune patent anti-Siglec-15)
Product Name : Anti-Siglec-15 / CD33L3 Reference Antibody (Medimmune patent anti-Siglec-15)synonym : null,productDescription :...
Anti-Siglec-15 / CD33L3 Reference Antibody (AB-25E9)
Product Name : Anti-Siglec-15 / CD33L3 Reference Antibody (AB-25E9)synonym : null,productDescription : Anti-Siglec-15 /...
Anti-BST2 / CD317 Reference Antibody (SBI Biotech patent anti-BST2)
Product Name : Anti-BST2 / CD317 Reference Antibody (SBI Biotech patent anti-BST2)synonym : null,productDescription...
A schematic form a summary with the strongest baseline predictors of
A schematic form a summary on the strongest baseline predictors of your gains in...
Nmethylated, respectively (Zilberman et al., 2007). According to the information from Zilberman
Nmethylated, respectively (Zilberman et al., 2007). Determined by the information from Zilberman et al....
Nditions, WT mice showed standard regenerating crypts (Figure 3D). Additional determination
Nditions, WT mice showed typical regenerating crypts (Figure 3D). Further determination on the proliferation...
The existing SP resistance based on quintuple mutations in Tanzania.in
The existing SP resistance according to quintuple mutations in Tanzania.in every single experiment. Digestion...
In IL-1 production, therefore indicating its function in the production of
In IL-1 production, as a result indicating its role in the production from the...
Taneously enhance even if assigned to placebo. These situations make it
Taneously increase even if assigned to placebo. These situations make it difficult two to...
Anti-S100A4 Reference Antibody (LK-1)
Product Name : Anti-S100A4 Reference Antibody (LK-1)synonym : null,productDescription : Anti-S100A4 Reference Antibody (LK-1)(CHB091)...
Anti-RTN4 / NOGO Reference Antibody (NG-101)
Product Name : Anti-RTN4 / NOGO Reference Antibody (NG-101)synonym : null,productDescription : Anti-RTN4 /...
Anti-RTN4 / NOGO Reference Antibody (atinumab)
Product Name : Anti-RTN4 / NOGO Reference Antibody (atinumab)synonym : null,productDescription : Anti-RTN4 /...
Anti-RHD / CD240d Reference Antibody (LFB Anti-RhD)
Product Name : Anti-RHD / CD240d Reference Antibody (LFB Anti-RhD)synonym : null,productDescription : Anti-RHD...
Anti-RAMP3 Reference Antibody (Medella patent anti-RAMP-3)
Product Name : Anti-RAMP3 Reference Antibody (Medella patent anti-RAMP-3)synonym : null,productDescription : Anti-RAMP3 Reference...
Anti-RHD / CD240d Reference Antibody (roledumab)
Product Name : Anti-RHD / CD240d Reference Antibody (roledumab)synonym : null,productDescription : Anti-RHD /...
Anti-Amyloid Beta Reference Antibody (Rockefeller U. patent anti-Amyloid Beta)
Product Name : Anti-Amyloid Beta Reference Antibody (Rockefeller U. patent anti-Amyloid Beta)synonym : null,productDescription...
Anti-PMELMouse mAb
Product Name : Anti-PMELMouse mAbsynonym : null,productDescription : NonemolecularWeight : 70endotoxin : Nonepurity :...
Anti-ATRX Mouse mAb
Product Name : Anti-ATRX Mouse mAbsynonym : null,productDescription : NonemolecularWeight : 283 kDaendotoxin :...
Anti-Bcl-2 Mouse mAb
Product Name : Anti-Bcl-2 Mouse mAbsynonym : productDescription : NonemolecularWeight : 18 kDaendotoxin :...
Atient has suffered from low progressive skeletal myopathy considering that childhood. Given that
Atient has suffered from low progressive skeletal myopathy considering that childhood. Considering that five...
N PFS by investigator assessment.* Univariate evaluation Baseline variable Therapy (lenalidomide
N PFS by investigator assessment.* Univariate analysis Baseline variable Remedy (lenalidomide versus IC) MIPI-based...
H before TGI, Total proteins have been isolated from the hippocampal CA
H ahead of TGI, Total proteins have been isolated from the hippocampal CA1 subfield...
E finish receptor occupancy and degradation. Consequently, we investigated the results
E full receptor occupancy and degradation. Hence, we investigated the effects of FTY720 treatment...
Ent of spontaneous seizures after SEAuthor Manuscript Writer Manuscript Author Manuscript
Ent of spontaneous seizures after SEAuthor Manuscript Writer Manuscript Writer Manuscript Writer ManuscriptAlthough the...
Ells is induced throughout the early phase of CSFV infection, indicating
Ells is induced through the early phase of CSFV infection, indicating that CSFV can...
Seedlings beneath non-HS situations. The information had at the very least 3 biological
Seedlings below non-HS situations. The information had at the least three biological replicates and...
Samples were kept protected from light for 24 h at RT before
Samples have been kept protected from light for 24 h at RT just before...
Pattern recognition molecules (PRMs) to their ligands, i.e., binding of
Pattern recognition molecules (PRMs) to their ligands, i.e., binding of C1q to antigenantibody complexes...
F protein crowders (A and B) Diffusion coefficients (A) and photos
F protein crowders (A and B) Diffusion coefficients (A) and images from confocal microscopy...
Hich was accompanied by the reversal of EMT plus the suppression
Hich was accompanied by the reversal of EMT as well as the suppression of...
Logy in Tg (PCSK9) mice indicates the lack of PCSK9 influences
Logy in Tg (PCSK9) mice indicates the lack of PCSK9 influences testicular function and...
The COVID-19 pandemic. Supplementary data to this short article is usually located
The COVID-19 pandemic. Supplementary data to this short article can be identified online at...
Inciple elements of ancestry applying data from select CpG web pages (32). To
Inciple components of ancestry working with details from select CpG web-sites (32). To adjust...
Carrier 19 loved ones (SLC19) of transporters which conform to the significant facilitator
Carrier 19 loved ones (SLC19) of transporters which conform for the main facilitator superfamily...
Enough to alleviate pain in OA, and opioids can create considerable
Enough to alleviate discomfort in OA, and opioids can make considerable adverse effects including...
Or on the neurotransmitters. Nevertheless, even though the transmitter involved in
Or in the neurotransmitters. However, even though the transmitter involved inside the activity could...
D in the DNA damage-induced, p53-dependent WIP1 transcript regulation. The
D from the DNA damage-induced, p53-dependent WIP1 transcript regulation. The increased WIP1 expression by...
Vitro three.three. ADAR2 Prevents Hepatocyte from Lipid Accumulation In VitroTo investigate the
Vitro 3.three. ADAR2 Prevents Hepatocyte from Lipid Accumulation In VitroTo investigate the effects of...
E high-quality evidence and standardized remedy, and the rate of utilization
E high-quality evidence and standardized treatment, as well as the price of utilization of...
Ting (WB) (Figure 4d, Figure S19, Supporting Data), which showed that
Ting (WB) (Figure 4d, Figure S19, Supporting Data), which showed that each SpAcDex-ATMO-21 NPs...
Against fruit rot pathogens under in vitro circumstances; (4) to assess the
Against fruit rot pathogens under in vitro conditions; (four) to assess the in vivo...
Ier survival curves have been derived from the KM plotter database (http
Ier survival curves had been derived from the KM plotter database (http://kmplot). The Cox...
In Figure 6, the sensory evaluation benefits abA 2 10.14 0.30effect on RC-SSP, though
In Figure six, the sensory evaluation outcomes abA two ten.14 0.30effect on RC-SSP, when...
Re AR and virulence genes, respectively. (A) Connections connections. Nodes in
Re AR and virulence genes, respectively. (A) Connections connections. Nodes in orange and blue...
Or predicting HVPG 12 mm Hg and hence could pretty predict the
Or predicting HVPG 12 mm Hg and hence could pretty predict the presence of...
He crucial point of TBI remedy. EA has an protective effect
He crucial point of TBI therapy. EA has an protective effect around the nervous...
D not proliferate for the duration of overnight culture, Raji cells slightly proliferated, and
D not proliferate through overnight culture, Raji cells slightly proliferated, and Jurkat and JINB8...
D) AZD4547. Data are represented as a percentage .E.M.Figure
D) AZD4547. Data are represented as a percentage .E.M.Figure 5. CAM-PDX chemotherapy resistance is...
0 or 1 Accessible tumor tissue No prior therapy for sophisticated gastric/GEJ
0 or 1 Offered tumor tissue No prior remedy for advanced gastric/GEJ cancer Stratification...
three mg/ml) as substrates. A. xylosoxidans ATCC 27061 and P. aeruginosa ATCC
3 mg/ml) as substrates. A. xylosoxidans ATCC 27061 and P. aeruginosa ATCC 27853 had...
Level of ATPBonferr test: chi square = 34.587, df = three, p = 0.025). (C) Inside the
Quantity of ATPBonferr test: chi square = 34.587, df = three, p = 0.025)....
Ting Details: Appendix S2. NVivo 12 application (QSR International) was applied to
Ting Facts: Appendix S2. NVivo 12 application (QSR International) was applied to boost the...
Ed making use of Byologic software (Protein Metrics Inc., San Carlos, CA), which
Ed employing Byologic computer software (Protein Metrics Inc., San Carlos, CA), which utilizes extracted...
Y was performed in 1956, however the official transplant plan was only
Y was performed in 1956, however the official transplant system was only six years...
N a multidimensional no cost power surface implicit of solvent coordinates primarily based
N a multidimensional no cost power surface implicit of solvent coordinates primarily based around...
90).Fc Oglycosylation from human IgG usion glycoproteinsThe IgG Fc is a
90).Fc Oglycosylation from human IgG usion glycoproteinsThe IgG Fc is a homodimer connected by...
Ing MBNL1 (Muscleblind Like Splicing Regulator 1) expression enhancers, and toxic RNA
Ing MBNL1 (Muscleblind Like Splicing Regulator 1) expression enhancers, and toxic RNA degradation ....
On for eight weeks, the mastering and memory capacity of the mice
On for 8 weeks, the learning and memory capacity of your mice in the...
Ne ASCT and reserve it for progressive illness. Ultimately, although consolidation
Ne ASCT and reserve it for progressive disease. Lastly, while consolidation therapy post transplantation...
In the PES minima. One example is, it was shown that [N
In the PES minima. For example, it was shown that has two accessible steady...
Ubchondral bone may behave as a disease-modifying role within the progression
Ubchondral bone may behave as a disease-modifying part in the progression of knee OA....
N the presence of Ca2+ ions, alginate solutions can type gels
N the presence of Ca2+ ions, alginate solutions can form gels by cooperative interaction...
E variety; HTN = hypertension; HLD = hyperlipidemia; DM = Diabetes Mellitus; CAD = coronary
E range; HTN = hypertension; HLD = hyperlipidemia; DM = Diabetes Mellitus; CAD =...
Processes due to the fact they may be distributed in many immuneresponsive cell subsets that
Processes mainly because they’re distributed in different immuneresponsive cell subsets that coordinate the adaptive...
Shown by mean of triplicates EM (left y-axis; break indicates the
Shown by mean of triplicates EM (left y-axis; break indicates the cut-off in the...
King status (under no circumstances; former; light; moderate and heavy) plus the poverty
King status (by no means; former; light; moderate and heavy) and also the poverty...
Corresponding to Asn118 in XEEL. Most structural calcium residues have been found
Corresponding to Asn118 in XEEL. Most structural calcium residues had been located to cluster...
Showed higher levels of proliferation and low background levels of apoptosis
Showed high levels of proliferation and low background levels of apoptosis (Fig. 7A )....
Fluid environment situations was evaluated by due to the ploughing of
Fluid atmosphere conditions was evaluated by as a consequence of the ploughing of really...
Ics, and fine targeting properties. This study focused at developing physically
Ics, and fine targeting properties. This study focused at creating physically stable DOX-LPHNs formulation...
The future, adequate amounts of purified MSCs has to be obtained [40, 41]. Nevertheless
The future, enough amounts of purified MSCs have to be obtained . However,...
Ferences in human and mouse cardiac electrophysiology, the mechanisms of intracellular
Ferences in human and mouse cardiac electrophysiology, the mechanisms of intracellular Ca2+ regulation are...
H the following therapeutic treatment possibilities: single dose IV oritavancin, dalbavancin
H the following therapeutic remedy solutions: single dose IV oritavancin, dalbavancin (either as a...
Atment (EOT) in nonresponders. Tumors of patients 002-10(12) and 005-11(14) displayed
Atment (EOT) in nonresponders. Tumors of individuals 002-10(12) and 005-11(14) displayed a reduction in...
Inside the very first 1, using the stepwise process, we determined the
In the initially 1, making use of the stepwise procedure, we determined the percentage...
Ens. Secondary endpoints had been thus objective response price (ORR), illness handle
Ens. Secondary endpoints have been hence objective response rate (ORR), illness handle price (DCR),...
Patient remained in remission until 2010. In June 2010 patient presented with fever
Patient remained in remission till 2010. In June 2010 patient presented with fever, malaise,...
On to 0 MYH91676-1791 treated cells.by direct interaction with viral
On to 0 MYH91676-1791 treated cells.by direct interaction with viral GP5 (Li et al.,...
M was utilised for MS acquisition in unfavorable ionization mode. The
M was used for MS acquisition in negative ionization mode. The mass spectrum parameters...
Ne None None None 3 months just after ASCT 1.510 14.160 two.950 1.131 five.250 10.380 36.180 16.670 1.590 Reference values five.five 015 3.3 two.five 7 34 35 25 4.carbohydrate
Ne None None None Three months immediately after ASCT 1.510 14.160 2.950 1.131 five.250...
Ation. The present work was performed by J-GZ in partial fulfillment
Ation. The present perform was performed by J-GZ in partial fulfillment in the requirements...
Housekeeping genes were synthesized and procured from Sigma Aldrich. Agarose gel
Housekeeping genes have been synthesized and procured from Sigma Aldrich. Agarose gel electrophoresis wasS...
Holesterol, and LDL in sufferers with sufferers with hypercholesterolemia, compared with
Holesterol, and LDL in patients with patients with hypercholesterolemia, compared with levels developed erides,...
The North American Association of Central Cancer Registries Hispanic Identification Algorithm
The North American Association of Central Cancer Registries Hispanic Identification Algorithm . Due to...
Group before DFT and also the imply MAP from the DFT- group
Group ahead of DFT and the mean MAP in the DFT- group were compared....
Ational imply to become stunted, underweight, or malnourished, respectively. Raw scores
Ational mean to be stunted, underweight, or malnourished, respectively. Raw scores obtained in the...
OparticlesThe antiretroviral activities of EuCF-DTG and FA-EuCF-DTG nanoparticles were assessed in
OparticlesThe antiretroviral activities of EuCF-DTG and FA-EuCF-DTG nanoparticles were assessed in MDM infected with...
Minority accrual to clinical trials have been published, the challenge remains
Minority accrual to clinical trials have already been published, the challenge remains to 1st...
Lyzed making use of Kaplan eier model and Cox proportional hazards models. All
Lyzed working with Kaplan eier model and Cox proportional hazards models. All estimates are...
F the pregnant ladies in the study was 24.7 four.1 years, and number
F the pregnant ladies within the study was 24.7 4.1 years, and quantity of...
On. 2016;38:9. von Meyenn F, Iurlaro M, Habibi E, Liu NQ, Salehzadeh-Yazdi
On. 2016;38:9. von Meyenn F, Iurlaro M, Habibi E, Liu NQ, Salehzadeh-Yazdi A, Santos...
Tion 1:1000 (1 h, room temp.). The rinsings of probes in buffered NaCl
Tion 1:1000 (1 h, room temp.). The rinsings of probes in buffered NaCl solution...
Nism underlying this abdominal pain . Hypersensitivity refers towards the enhanced sensation
Nism underlying this abdominal pain . Hypersensitivity refers for the increased sensation of stimuli:...
S also led us to seek out that inhibiting ALDH1A3 led
S also led us to find that inhibiting ALDH1A3 led to a lower of...
Gents that induced a modify in pHi or [Ca2+]i, statistical
Gents that induced a change in pHi or i, statistical evaluation was performed by...
Swiftly induces muscle insulin resistance for glucose uptake by means of the activation
Quickly induces muscle insulin resistance for glucose uptake by way of the activation of...
D endothelial cells) that we previously created from sorted CRC cell
D endothelial cells) that we previously developed from sorted CRC cell populations (Isella et...
On, deregulation of cell survival at the same time as proliferation, invasion and
On, deregulation of cell survival as well as proliferation, invasion and angiogenesis . Having...
Infection and lysis,191 antitumor immune response induction22,23 and acute vascular disruption.
Infection and lysis,191 antitumor immune response induction22,23 and acute vascular disruption.24 PexaVec is derived...
Node metastasis had been considerable predictors of PFS. However both anti-p53 antibody
Node metastasis had been significant predictors of PFS. Even so both anti-p53 antibody and...
Ctivation in the STINGAugust 2017 Volume 91 Problem 16 e00535-17 jvi.asm.orgDeschamps
Ctivation on the STINGAugust 2017 Volume 91 Concern 16 e00535-17 jvi.asm.orgDeschamps and KalamvokiJournal of...
E have been walking at 15cm/s. The video photos had been recorded
E have been walking at 15cm/s. The video photos were recorded and analyzed with...
S. In addition, protein spot 167 also belonged to this pattern in
S. Moreover, protein spot 167 also belonged to this pattern in Yunong 3114, when...
Ory syncytial viruses, exportinsIntroduction: the Global Health ProblemViral respiratory illness (VRD
Ory syncytial viruses, exportinsIntroduction: the International Overall health ProblemViral respiratory illness (VRD) benefits inside...
Doped or undoped, are applied to simulate the unique regional environments
Doped or undoped, are utilised to simulate the unique nearby environments explored by a...
Th or with no asthma [11]. Increasing proof points for the truth that
Th or without having asthma . Increasing proof points to the truth that the...
Herols, IU/kg Lauric acid [12:0] Myristic acid [14:0] Palmitic acid [16:0] Stearic acid
Herols, IU/kg Lauric acid Myristic acid Palmitic acid Stearic acid ...
Sease in JHMV-infected mice, irrespective if transplanted with GFP-NPCs or handled
Sease in JHMV-infected mice, regardless if transplanted with GFP-NPCs or taken care of with...
T HSCT. There have been no mismatches in the ABO blood groups.
T HSCT. There were no mismatches from the ABO blood groups. Taken with each...
In DMSO situations). Transient transfection siRNA and mimics. siRNA (MUC1, HIF
In DMSO situations). Transient transfection siRNA and mimics. siRNA (MUC1, HIF2A, All Stars Damaging...
Erial clearance rates, increases neutrophil surface adhesion molecule expression, enhances neutrophil
Erial clearance rates, increases neutrophil surface adhesion molecule expression, enhances neutrophil chemotaxis, reduces burn...
Ells treated with recombinant VACVs was analyzed (Table two). We identified that
Ells treated with recombinant VACVs was analyzed (Table 2). We identified that the cell...
Thin 5 years and as much as 40 within ten years when compared with 20 years in
Thin five years and as much as 40 inside 10 years in comparison with...
Patient security along with the advancement of Precision Medicine. This new study
Patient security and also the advancement of Precision Medicine. This new study attempts to...
Ct free-standing LbL films.Supplies 2013, six Figure 1. Chemical structure of poly(diallylamine-co-maleic
Ct free-standing LbL films.Materials 2013, six Figure 1. Chemical structure of poly(diallylamine-co-maleic acid) (PDAMA).CHCHH2...
D blood cells within the urine. When visible it is termed
D blood cells in the urine. When visible it is actually termed gross hematuria...
E with enhanced abiotic stress tolerance [59, 60]. The ONAC095-SRDX plants contained
E with enhanced abiotic anxiety tolerance . The ONAC095-SRDX plants contained an elevated...
Ere followed for 2 years to study the biological causes and functional
Ere followed for two years to study the biological causes and functional consequences of...
Act as an efficient inflammasome inducer just after their injection into mice.
Act as an effective inflammasome inducer soon after their injection into mice. We injected...
Ous hemorrhage might have a number of etiologies, but manifest and occult trauma
Ous hemorrhage may have various etiologies, but manifest and occult trauma is most common....
SIRT1 protein and cytokines have been detected. All of the operations of transfection
SIRT1 protein and cytokines have been detected. Each of the operations of transfection have...
Iating the self-association with the lysozyme variants into oligomeric species and
Iating the self-association in the lysozyme variants into oligomeric species and subsequently into amyloid...
HCL-v situations showed simultaneous expression of CD5 and CD23. All 9 SMZL
HCL-v circumstances showed simultaneous expression of CD5 and CD23. All 9 SMZL cases showed...
Chlorinated biphenyls (PCBs) are within a category of persistent organic pollutants
Chlorinated biphenyls (PCBs) are within a category of persistent organic pollutants (POPs) which can...
Events (AEs) have been monitored throughout the study. Benefits: All enrolled patients
Events (AEs) were monitored throughout the study. Outcomes: All enrolled sufferers had been integrated...
Testing and an alpha of 0.05 was made use of. A log-rank Mantel-Cox test
Testing and an alpha of 0.05 was utilised. A log-rank Mantel-Cox test was applied...
Rhinitis, and groups C (n = ten, asthma/rotatory handle) and D (n
Rhinitis, and groups C (n = ten, asthma/rotatory manage) and D (n = ten,...
To block autophagic flux. Next, dual therapy with CQ and WA
To block autophagic flux. Next, dual remedy with CQ and WA plus rapamycin, which...
Formation in substituted the bands in 832 cm of =O groups and
Formation in substituted the bands in 832 cm of =O groups along with the...
Hemical profile of your animal groups is shown in Table 1. Mice
Hemical profile of your animal groups is shown in Table 1. Mice fed an...
Of CD in nanomaterials can be applied to impart higher DTX
Of CD in nanomaterials could be used to impart high DTX loading capabilities (Zhao...
G beads had been applied in anti-ER or anti–tubulin antibodies. An anti-rabbit
G beads had been used in anti-ER or anti–tubulin antibodies. An anti-rabbit IgG beads...
2 (three) (four)In all four circumstances, the negative Gibbs energy of reaction values
two (three) (4)In all four circumstances, the damaging Gibbs power of reaction values indicate...
Se re existence.Commented [AC2R1]: I rep one particular, just cropped
Se re existence.Commented : I rep one, just cropped and locked caption is cut-off...
Equally blocked by either CB1 antagonist AM251 or CB2 antagonist SREqually blocked by either CB1
Equally blocked by either CB1 antagonist AM251 or CB2 antagonist SREqually blocked by either...
0.05). Regression analysis showed that SGR, FI, FE and PER quadratically responded
0.05). Regression analysis showed that SGR, FI, FE and PER quadratically responded to improved...
Twelve production fluid samples and each of the cloned sequences had been affiliated
Twelve production fluid samples and each of the cloned sequences had been affiliated with...
H information point ( D). 1 Statistically important difference (P 0.005) involving the plasma
H data point ( D). 1 Statistically important difference (P 0.005) between the plasma...
Ation of immunosuppression drugs, including Cyclophosphamide (CY), a chemotherapeutic agent that
Ation of immunosuppression drugs, which includes Cyclophosphamide (CY), a chemotherapeutic agent that exhibits a...
Activity against the RET kinase; nevertheless, no selective RET inhibitors have
Activity against the RET kinase; on the other hand, no selective RET inhibitors have...
Dicated that the overall DCR was 27 (95 CI: 130 ) along with the median PFS
Dicated that the general DCR was 27 (95 CI: 130 ) plus the median...
The Chinese Ministry of Overall health Grant (No. 2013ZX10003006).
International Journal ofEnvironmental The Chinese Ministry of Health Grant (No. 2013ZX10003006). International Journal ofEnvironmental...
E body of proof exists demonstrating that n-3 PUFAs can evoke
E body of proof exists demonstrating that n-3 PUFAs can evoke endotheliumdependent NO-mediated relaxation....
St graft survival (18.0 years) and greatest overall survival (23.two years) and most
St graft survival (18.0 years) and greatest all round survival (23.two years) and most...
Articles have been 800 nm. As a result, SN-38/NCs-A showed the most beneficial tumor accumulation
Articles have been 800 nm. Therefore, SN-38/NCs-A showed the ideal tumor accumulation among the...
Giterm=RefSeq) and from expressed sequence tag (EST) contigs (://phrap.org
Giterm=RefSeq) and from expressed sequence tag (EST) contigs (://phrap.org/green_group/est_assembly/human/ gene_number_methods.html). Every mRNA or EST...
4] such as Myc . Guidelines advise a strict surveillance protocol [5] in APC
4] like Myc . Suggestions advise a strict surveillance protocol in APC ,...
, and enhanced travel distances. Curcumin remarkably elevated platform crossing number and
, and increased travel distances. Curcumin remarkably enhanced platform crossing quantity and time spent...
2, P2Y4, and P2Y6 requires activation of calcium-related pathways, at some point
2, P2Y4, and P2Y6 requires activation of calcium-related pathways, at some point leading to...
Y of illnesses, age distribution of population, geographic spread and availability
Y of illnesses, age distribution of population, geographic spread and availability ofTable three. Prime...
Rior to FOLFIRI in individuals previously treated with oxaliplatin-based chemotherapy,[9] theRior to FOLFIRI in sufferers
Rior to FOLFIRI in individuals previously treated with oxaliplatin-based chemotherapy, theRior to FOLFIRI in...
S had been produced.ORIGINAL RESEARCHInsight and Remedy Outcomes in Schizophrenia: Post-hocS were produced.ORIGINAL RESEARCHInsight and
S had been produced.ORIGINAL RESEARCHInsight and Remedy Outcomes in Schizophrenia: Post-hocS were produced.ORIGINAL RESEARCHInsight...
R for Itr1 gene, qIcy2-F and qIcy2-R for IcyR for Itr1 gene, qIcy2-F and qIcy2-R
R for Itr1 gene, qIcy2-F and qIcy2-R for IcyR for Itr1 gene, qIcy2-F and...
N at 4 . The Cathepsin B Protein Storage & Stability sedimented mitochondrial pellet was
N at 4 . The Cathepsin B Protein Storage & Stability sedimented mitochondrial pellet...
Genome to make bait-IL-6R alpha Protein MedChemExpress reporter strains. A cDNA library was constructed fromGenome
Genome to make bait-IL-6R alpha Protein MedChemExpress reporter strains. A cDNA library was constructed...
The pH of TPP affects the electronegative potential on the moleculeThe pH of TPP affects
The pH of TPP affects the electronegative potential on the moleculeThe pH of TPP...
L phased-arrayed head coil. All participants were verbally instructed to stayL phased-arrayed head coil. All
L phased-arrayed head coil. All participants were verbally instructed to stayL phased-arrayed head coil....
Articles were 800 nm. Thus, SN-38/NCs-A IL-4, Human showed the most effective tumor accumulationArticles have
Articles were 800 nm. Thus, SN-38/NCs-A IL-4, Human showed the most effective tumor accumulationArticles...
PASK IBA 3+ (IBA Streptavidin Magnetic Beads custom synthesis Lifesciences), pFRED143 (Ludwig et al., 1999);
PASK IBA 3+ (IBA Streptavidin Magnetic Beads custom synthesis Lifesciences), pFRED143 (Ludwig et al.,...
Cations of individuals undergoing operations (1). Despite many researches and availability ofCations of individuals undergoing
Cations of individuals undergoing operations (1). Despite many researches and availability ofCations of individuals...
As shown across species.18,23,24,79 The most prominent phenotype in pls3 KOAs shown across species.18,23,24,79 Probably
As shown across species.18,23,24,79 The most prominent phenotype in pls3 KOAs shown across species.18,23,24,79...
Gd-IgA1 than do the cells from HCs, concordantly with the serumGd-IgA1 than do the cells
Gd-IgA1 than do the cells from HCs, concordantly with the serumGd-IgA1 than do the...
Aling from human Serum Albumin/ALB Protein site breast cancer cells. Morin and MST-312 therapy inhibitedAling
Aling from human Serum Albumin/ALB Protein site breast cancer cells. Morin and MST-312 therapy...
Mice. Values are imply D and are normalized with respect toMice. Values are imply
Mice. Values are imply D and are normalized with respect toMice. Values are imply...
Bsorption of Cy5 at 280 nm (0.05 sirtuininhibitorCy5 absorption at 650 nm), and byBsorption of
Bsorption of Cy5 at 280 nm (0.05 sirtuininhibitorCy5 absorption at 650 nm), and byBsorption...
0.five M urea, 300 mM IgG4 Fc Protein Formulation imidazole, 0.1 rapigest (or Nonidet
0.five M urea, 300 mM IgG4 Fc Protein Formulation imidazole, 0.1 rapigest (or Nonidet...
. Enzyme histochemistry permitted to localize trypsin-like enzymes in T. absoluta L. Enzyme histochemistry permitted
. Enzyme histochemistry permitted to localize trypsin-like enzymes in T. absoluta L. Enzyme histochemistry...
Partial response; SD, steady disease; PD, progressive illness; PS, performance status.Partial response; SD, stable illness;
Partial response; SD, steady disease; PD, progressive illness; PS, performance status.Partial response; SD, stable...
Itor12.two years and 80 had been female, 60 Caucasian, and 60
Itor12.two years and 80 had been female, 60 Caucasian, and 60 Scl-70 constructive. Duration...
Ofrontal cortex/mPFC (BA 11/10) Suitable FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10) Proper
Ofrontal cortex/mPFC (BA 11/10) Suitable FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10)...
Containing EDTA-2Na (15 mL/kg), followed by centrifugation at 1000 g atContaining EDTA-2Na (15 mL/kg), followed
Containing EDTA-2Na (15 mL/kg), followed by centrifugation at 1000 g atContaining EDTA-2Na (15 mL/kg),...
NaCl, 100 mM sodium acetate (pH 5.5) containing 1 mg/ml pronase, and 1 mgNaCl, one
NaCl, 100 mM sodium acetate (pH 5.5) containing 1 mg/ml pronase, and 1 mgNaCl,...
YFIGURE 2. Gut function is improved in Tg mice given oral FTYYFIGURE two. Gut function
YFIGURE 2. Gut function is improved in Tg mice given oral FTYYFIGURE two. Gut...
Ent NCDs/chronic illnesses.4. Frequent Outcomes of DIT and Risk ofEnt NCDs/chronic illnesses.four. Frequent Outcomes of
Ent NCDs/chronic illnesses.4. Frequent Outcomes of DIT and Risk ofEnt NCDs/chronic illnesses.four. Frequent Outcomes...
_F: GACTTCATGCCCACCA TCTT, MCM5_R: TCACGTGCAGAGTGATGACA; MCM6_F: AACCAGCAACTTTCCACCAC, MCM6_R_F: GACTTCATGCCCACCA TCTT, MCM5_R: TCACGTGCAGAGTGATGACA; MCM6_F: AACCAGCAACTTTCCACCAC, MCM6_R:
_F: GACTTCATGCCCACCA TCTT, MCM5_R: TCACGTGCAGAGTGATGACA; MCM6_F: AACCAGCAACTTTCCACCAC, MCM6_R_F: GACTTCATGCCCACCA TCTT, MCM5_R: TCACGTGCAGAGTGATGACA; MCM6_F: AACCAGCAACTTTCCACCAC,...
Tor experiments indicating the involvement of p38 but not JAK2 inTor experiments indicating the involvement
Tor experiments indicating the involvement of p38 but not JAK2 inTor experiments indicating the...
Angerhans cells are skin-resident immune cells that associate closely with keratinocytesAngerhans cells are skin-resident immune
Angerhans cells are skin-resident immune cells that associate closely with keratinocytesAngerhans cells are skin-resident...
Lthough an undetectable viral level at week 4 or 12 is actually a excellentLthough an
Lthough an undetectable viral level at week 4 or 12 is actually a excellentLthough...
Lar obligate pathogenic bacteria with similar developmental cycle and cell biologyLar obligate pathogenic bacteria with
Lar obligate pathogenic bacteria with similar developmental cycle and cell biologyLar obligate pathogenic bacteria...
Oral gyrus is situated amongst the anterior and posterior lateral portionOral gyrus is positioned between
Oral gyrus is situated amongst the anterior and posterior lateral portionOral gyrus is positioned...
Ly distinct (P0.05). There have been some probable explanations for these benefits.Ly distinct (P0.05). There
Ly distinct (P0.05). There have been some probable explanations for these benefits.Ly distinct (P0.05)....
Olitinib but not Tofacinitib DKK-3 Protein site decreased ALDH+ lung cancer cells indicating theOlitinib but
Olitinib but not Tofacinitib DKK-3 Protein site decreased ALDH+ lung cancer cells indicating theOlitinib...
Ve explored the link involving childhood Cadherin-11, Human (HEK293, His) trauma exposure, cancer remedy, dysregulationVe
Ve explored the link involving childhood Cadherin-11, Human (HEK293, His) trauma exposure, cancer remedy,...
Toxins and citrinin are mycotoxins made by fungi developing on uniqueToxins and citrinin are mycotoxins
Toxins and citrinin are mycotoxins made by fungi developing on uniqueToxins and citrinin are...
N. Particularly, when categorized by MSKCC criteria,13 intermediate- and poor-risk patientsN. Especially, when categorized by
N. Particularly, when categorized by MSKCC criteria,13 intermediate- and poor-risk patientsN. Especially, when categorized...
S in TF and TFRC genes in between analyzed groups of individuals.S in TF and
S in TF and TFRC genes in between analyzed groups of individuals.S in TF...
Revisiae prions. Very first, overexpression of Ctr4 as an YFP fusion resultedRevisiae prions. First, overexpression
Revisiae prions. Very first, overexpression of Ctr4 as an YFP fusion resultedRevisiae prions. First,...
Ra certain for SAD1 (16) failed to detect cross-reacting protein in proteinRa distinct for SAD1
Ra certain for SAD1 (16) failed to detect cross-reacting protein in proteinRa distinct for...
Ence of three M UMP. The activity of your enzymes present inEnce of 3 M
Ence of three M UMP. The activity of your enzymes present inEnce of 3...
At roughly equal proportions beneath basal culture situations (31). Also toAt about equal proportions beneath
At roughly equal proportions beneath basal culture situations (31). Also toAt about equal proportions...
G molecules in dM or uM, cells were permeabilized (Cytofix/CytopermG molecules in dM or uM,
G molecules in dM or uM, cells were permeabilized (Cytofix/CytopermG molecules in dM or...
N. Nat Cell Biol. 2012;14(12):1282sirtuininhibitor4. 57. Kong LN, Zuo PP, Mu LN. Nat Cell Biol.
N. Nat Cell Biol. 2012;14(12):1282sirtuininhibitor4. 57. Kong LN, Zuo PP, Mu LN. Nat Cell...
H.S.; Fuchs, K.; Sullivan, L.; Comstock, C.H.; Sade, G.H.S.; Fuchs, K.; Sullivan, L.; Comstock, C.H.;
H.S.; Fuchs, K.; Sullivan, L.; Comstock, C.H.; Sade, G.H.S.; Fuchs, K.; Sullivan, L.; Comstock,...
Ofrontal cortex/mPFC (BA 11/10) Proper FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10) Correct
Ofrontal cortex/mPFC (BA 11/10) Proper FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10)...
Articles had been 800 nm. Therefore, SN-38/NCs-A showed the most effective tumor accumulationArticles had been
Articles had been 800 nm. Therefore, SN-38/NCs-A showed the most effective tumor accumulationArticles had...
) was heated to 70 below Ar2 for 18 h. Just after cooling
) was heated to 70 below Ar2 for 18 h. Just after cooling to...
Cantly in B6.TNF-/- mice over the course of illnessCantly in B6.TNF-/- mice over the course
Cantly in B6.TNF-/- mice over the course of illnessCantly in B6.TNF-/- mice over the...
Ponse towards the GFD; (2) measuring the effect of reintroducing gluten followingPonse for the GFD;
Ponse towards the GFD; (2) measuring the effect of reintroducing gluten followingPonse for the...
Ofrontal cortex/mPFC (BA 11/10) Right FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10) Suitable
Ofrontal cortex/mPFC (BA 11/10) Right FEF, orbitofrontal cortex/mPFC (BA 11/10) CognitiveOfrontal cortex/mPFC (BA 11/10)...
Neously with 1 106 BE (2)-c cells followed by instant therapy with 5000 mgNeously with
Neously with 1 106 BE (2)-c cells followed by instant therapy with 5000 mgNeously...
Y was detected only in one particular pregnancy with pre-eclampsia and fetalY was detected only
Y was detected only in one particular pregnancy with pre-eclampsia and fetalY was detected...
At mimics the GTP-bound state in the protein (GTR1-Q65L) increases TORC1 activity during amino acid
At mimics the GTP-bound state in the protein (GTR1-Q65L) increases TORC1 activity during amino...
Was observed in subpopulation of renal medullary cells which can be arrangedWas observed in subpopulation
Was observed in subpopulation of renal medullary cells which can be arrangedWas observed in...
Rectly and consequently stay prone to suffer from skinning injury more thanRectly and consequently stay
Rectly and consequently stay prone to suffer from skinning injury more thanRectly and consequently...
Is positioned downstream of H2 O2 to mediate H2 O2 -induced sarcKATP channel stimulation in
Is positioned downstream of H2 O2 to mediate H2 O2 -induced sarcKATP channel stimulation...
Ere obtainable for the deceased kids. Genetic testing also identified the exact same mutation in
Ere obtainable for the deceased kids. Genetic testing also identified the exact same mutation...
E 1A) was adapted from previous work5,28. The chip was laser cut from acrylic sheets
E 1A) was adapted from previous work5,28. The chip was laser cut from acrylic...
Fter treatment of LPS-stimulated macrophages with the drug I-BET (40), expression ofFter remedy of LPS-stimulated
Fter treatment of LPS-stimulated macrophages with the drug I-BET (40), expression ofFter remedy of...
Al., 2013). However, muscle- or liver-specific deletion of SIRT3 GDF-11/BMP-11, Human (HEK293) didn't resultAl., 2013).
Al., 2013). However, muscle- or liver-specific deletion of SIRT3 GDF-11/BMP-11, Human (HEK293) didn’t resultAl.,...
Altered, indicating the AITRL/TNFSF18 Trimer Protein Source presence of oxidative tension [18]. This effect was
Altered, indicating the AITRL/TNFSF18 Trimer Protein Source presence of oxidative tension . This effect...
Ctious Diseases, 2011, 204 Suppl three;S757?60. doi:10.1093/infdis/ jir296 pmid:21987747 35. Pan Y et al. Reston
Ctious Diseases, 2011, 204 Suppl three;S757?60. doi:10.1093/infdis/ jir296 pmid:21987747 35. Pan Y et al....
Al cells [6]. This finding suggests that ECyd causes Vaults dysfunction preferentiallyAl cells [6]. This
Al cells . This finding suggests that ECyd causes Vaults dysfunction preferentiallyAl cells ....
Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and increasingOrmin activates AMPK by inhibiting
Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and increasingOrmin activates AMPK by...
Xpression didn't exhibit a important effect on all round survival (data not shown). To validate
Xpression didn’t exhibit a important effect on all round survival (data not shown). To...
Ncovered an inverse connection between the frequency of syntillas and amperometric ACTB Protein web events
Ncovered an inverse connection between the frequency of syntillas and amperometric ACTB Protein web...
Ors may perhaps TGF beta 2/TGFB2 Protein site present novel signifies for the remedy of
Ors may perhaps TGF beta 2/TGFB2 Protein site present novel signifies for the remedy...
Ever making use of sugammadex in their everyday practice. Occasional use of sugammadexEver employing sugammadex
Ever making use of sugammadex in their everyday practice. Occasional use of sugammadexEver employing...
Exes. The cathode buffer was 50 mM tricine, 15 mM Bis-Tris, pH 7.0, andExes. The
Exes. The cathode buffer was 50 mM tricine, 15 mM Bis-Tris, pH 7.0, andExes....
Is hydrogen bonded to water molecules by way of the ester and carboxy moieties, forming
Is hydrogen bonded to water molecules by way of the ester and carboxy moieties,...
Ive instances with water and subjected to TFA hydrolysis (two M final concentration) for three
Ive instances with water and subjected to TFA hydrolysis (two M final concentration) for...
Maturity. Bar=50 m. (C) SEM picture of mature OsAP65+/+ pollen grains. Bar=50 m. (D) A
Maturity. Bar=50 m. (C) SEM picture of mature OsAP65+/+ pollen grains. Bar=50 m. (D)...
Of inner sequence positions, they call for changes of standard RNA synthesisOf internal sequence positions,
Of inner sequence positions, they call for changes of standard RNA synthesisOf internal sequence...
Y with the residue as a criterion and enhanced its performance. Having said that, so
Y with the residue as a criterion and enhanced its performance. Having said that,...
Vs glargine (n = 159) plus metformin (each arms) FBG: 8.1 vs 6.5 mmol/L (P
Vs glargine (n = 159) plus metformin (each arms) FBG: 8.1 vs 6.5 mmol/L...
Ncubated with Alexa Fluor?488 fluorochrome-conjugated secondary antibody (Invitrogen, USA) in PBS, and had been then
Ncubated with Alexa Fluor?488 fluorochrome-conjugated secondary antibody (Invitrogen, USA) in PBS, and had been...
Es relies on seemingly telomerespecific molecular pathways. Nevertheless, it appears thatEs relies on seemingly telomerespecific
Es relies on seemingly telomerespecific molecular pathways. Nevertheless, it appears thatEs relies on seemingly...
Ain promoter activities in the root-hair zone. A strong and veryAin promoter activities in the
Ain promoter activities in the root-hair zone. A strong and veryAin promoter activities in...
Em for three min, which was confirmed to be adequate for equilibration. The data are
Em for three min, which was confirmed to be adequate for equilibration. The data...
Anosine pentaphosphate (pppGpp), accumulate beneath starvation circumstances (Chatterji and Ojha, 2001). On the one hand
Anosine pentaphosphate (pppGpp), accumulate beneath starvation circumstances (Chatterji and Ojha, 2001). On the one...
Ovide additional information about the underlying causes of connected ailments, for example Hirschsprung's and OIBD1,14,17.
Ovide additional information about the underlying causes of connected ailments, for example Hirschsprung’s and...
Copoeia, System II, a paddle strategy, was performed making use of a RCZ-Copoeia, Approach II,
Copoeia, System II, a paddle strategy, was performed making use of a RCZ-Copoeia, Approach...
Exes. The cathode buffer was 50 mM tricine, 15 mM Bis-Tris, pH 7.0, andExes. The
Exes. The cathode buffer was 50 mM tricine, 15 mM Bis-Tris, pH 7.0, andExes....
Overexpressing cells. Fluorescence was excited employing the 488 nm line of the argon laser and
Overexpressing cells. Fluorescence was excited employing the 488 nm line of the argon laser...
Ing aspect for AF. A Danish cohort study supports the observation in the Japanese study;
Ing aspect for AF. A Danish cohort study supports the observation in the Japanese...
Ls. Discontinuations due to AEs numerically favoured NPH-insulin, but this resultLs. Discontinuations because of AEs
Ls. Discontinuations due to AEs numerically favoured NPH-insulin, but this resultLs. Discontinuations because of...
Expression of its coding counterpart, AFAP1. Precise Inhibition of AFAP1-ASExpression of its coding counterpart, AFAP1.
Expression of its coding counterpart, AFAP1. Precise Inhibition of AFAP1-ASExpression of its coding counterpart,...
Unctate staining was also visible in type II alveolar epithelial cells (figure 3E, F).DISCUSSION To
Unctate staining was also visible in type II alveolar epithelial cells (figure 3E, F).DISCUSSION...
Ied from an Iranian population had C-shaped canals. Inside a study of Rahimi et al.
Ied from an Iranian population had C-shaped canals. Inside a study of Rahimi et...
Ks post-infection. These benefits suggest a correlation among the lack of AQP4 and decreased generation
Ks post-infection. These benefits suggest a correlation among the lack of AQP4 and decreased...
Copoeia, IFN-gamma Protein Species System II, a paddle strategy, was performed employing a RCZ-Copoeia, Technique
Copoeia, IFN-gamma Protein Species System II, a paddle strategy, was performed employing a RCZ-Copoeia,...
Wnt4 Protein MedChemExpress Sponding band images from the MEFs. MWAs. The cells were lysedSponding band
Wnt4 Protein MedChemExpress Sponding band images from the MEFs. MWAs. The cells were lysedSponding...
Immature granulocytes using the absence of granulocytic dysplasia, monocytosis, eosinophilia, and basophilia [1]. Further clinicopathologic
Immature granulocytes using the absence of granulocytic dysplasia, monocytosis, eosinophilia, and basophilia . Further...
Bust analogue of mean, and IQR is actually a robust measure of variability; functionals which
Bust analogue of mean, and IQR is actually a robust measure of variability; functionals...
ML) LDL-C5/HDL-C6 non-HDL-C/HDL-C 26.45 ?1.06 63.19 ?2.52 62.15 ?1.90 50.ten ?1.05 29.41 ?1.38 17.76 ?0.32
ML) LDL-C5/HDL-C6 non-HDL-C/HDL-C 26.45 ?1.06 63.19 ?2.52 62.15 ?1.90 50.ten ?1.05 29.41 ?1.38 17.76...
The Ca2 source. We demonstrate that the time course for suchThe Ca2 supply. We demonstrate
The Ca2 source. We demonstrate that the time course for suchThe Ca2 supply. We...
Channel modulators. J Biol Chem 275(47):36556?6561. 40. Durham WJ, et al. (2008) RyR1 S-nitrosylation underlies
Channel modulators. J Biol Chem 275(47):36556?6561. 40. Durham WJ, et al. (2008) RyR1 S-nitrosylation...
Hanges underlying 6OHDA-mediated dysfunction (Figure 6C). The present findings demonstrated that (1) 6-OHDA quickly mTORC1
Hanges underlying 6OHDA-mediated dysfunction (Figure 6C). The present findings demonstrated that (1) 6-OHDA quickly...
He 900 mM TEA-Cl maintained the osmotic balance and chloride concentration across the bilayer though
He 900 mM TEA-Cl maintained the osmotic balance and chloride concentration across the bilayer...
Nd 3 months following switching drugs. P 0.001, P = 0.006 in comparison with
Nd 3 months following switching drugs. P 0.001, P = 0.006 in comparison with...
Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and escalatingOrmin activates AMPK by inhibiting
Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and escalatingOrmin activates AMPK by...
N Yua,b, Young Eun Hana,b, Young-Sun Jia,b, Keunhee Ohc, Jong-Woo Sohna, Ajin Lima, Jae-Pyo Jeonb,
N Yua,b, Young Eun Hana,b, Young-Sun Jia,b, Keunhee Ohc, Jong-Woo Sohna, Ajin Lima, Jae-Pyo...
group2 substitutions from the combined group1234 substitutions (hSTINGgroup134) strongly diminished DMXAA activation, whereas loss of
group2 substitutions from the combined group1234 substitutions (hSTINGgroup134) strongly diminished DMXAA activation, whereas loss...
Localization (73). Interestingly, the deletion from the LI domain abolished IFNGR1 capping and redistributed IFNGR1
Localization (73). Interestingly, the deletion from the LI domain abolished IFNGR1 capping and redistributed...
Such because the beta cells on the pancreas) and non-self (this kind ofSuch as the
Such because the beta cells on the pancreas) and non-self (this kind ofSuch as...
Ne hundred independent docking runs had been carried out for the disaccharide.Ne hundred independent docking
Ne hundred independent docking runs had been carried out for the disaccharide.Ne hundred independent...
Accordance with the suggestions within the Guide for the Care and Use of Laboratory Animals
Accordance with the suggestions within the Guide for the Care and Use of Laboratory...
E hydroxylation within the heart, possible inhibitors using a documented history of cardiotoxicity have been
E hydroxylation within the heart, possible inhibitors using a documented history of cardiotoxicity have...
Nd/or decreased survival (Table 1) [63, 64, 66-69, 71-73]. New diagnostic methods are linking previously
Nd/or decreased survival (Table 1) . New diagnostic methods are linking...
Of ICH had been unique involving the review groups. These benefits couldOf ICH were distinct
Of ICH had been unique involving the review groups. These benefits couldOf ICH were...
Rnatant was recentrifuged at 16,000 g for 15 min, and also the pellets have beenRnatant
Rnatant was recentrifuged at 16,000 g for 15 min, and also the pellets have...
Actin, 1 l of cDNA template and the following specific primers had been made use
Actin, 1 l of cDNA template and the following specific primers had been made...
Any phenotypic alteration within the adipose tissue of Agtrap??mice below HF loading, and Agtrap??mice certainly
Any phenotypic alteration within the adipose tissue of Agtrap??mice below HF loading, and Agtrap??mice...
Ition of its metabolic end item calcium oxalate crystals in numerousItion of its metabolic end
Ition of its metabolic end item calcium oxalate crystals in numerousItion of its metabolic...
Tic PME activity is itself post-translationally controlled by way of a 1 : 1 interaction
Tic PME activity is itself post-translationally controlled by way of a 1 : 1...
Munol 2011; 187: 2181?192. 23 Kline JN, Cowden JD, Hunninghake GW, Schutte BC, Watt JL,
Munol 2011; 187: 2181?192. 23 Kline JN, Cowden JD, Hunninghake GW, Schutte BC, Watt...
At 10 kHz (Molecular Devices). Liquid junction potentials were calculated from the Clampex built-in JPCalcW
At 10 kHz (Molecular Devices). Liquid junction potentials were calculated from the Clampex built-in...
By environmental things, which includes siblings and care centers (15). The physical connection between the
By environmental things, which includes siblings and care centers (15). The physical connection between...
Fter treatment method of LPS-stimulated macrophages with the drug I-BET (forty), expression ofFter therapy of
Fter treatment method of LPS-stimulated macrophages with the drug I-BET (forty), expression ofFter therapy...
Salvage pathway and hydroxykynurenine within the de novo pathway, of NADSalvage pathway and hydroxykynurenine inside
Salvage pathway and hydroxykynurenine within the de novo pathway, of NADSalvage pathway and hydroxykynurenine...
Pe?probe targeting BCAR4 was designed and synthesized by Advanced Cell Diagnostics and detection of BCAR4
Pe?probe targeting BCAR4 was designed and synthesized by Advanced Cell Diagnostics and detection of...
Ectra have been visualized employing Sparky (Goddard TD, Kneller DG, SPARKY3, University of California, San
Ectra have been visualized employing Sparky (Goddard TD, Kneller DG, SPARKY3, University of California,...
N (Supplementary Fig. S4A at JXB on the web). To confirm that the male defect
N (Supplementary Fig. S4A at JXB on the web). To confirm that the male...
N by proteolytic enzymes,9 these improve cancer cell's capability forN by proteolytic enzymes,9 these boost
N by proteolytic enzymes,9 these improve cancer cell’s capability forN by proteolytic enzymes,9 these...
Approaches just usually do not have the capacity to home-in on small features on the
Approaches just usually do not have the capacity to home-in on small features on...
Was consistent and much more than 60 . PK evaluation showed that TK900D and TK900E
Was consistent and much more than 60 . PK evaluation showed that TK900D and...
Cells may perhaps be FP Agonist review present in our cultures; nevertheless, further testing would
Cells may perhaps be FP Agonist review present in our cultures; nevertheless, further testing...
Ition of its metabolic finish product calcium oxalate crystals in variousItion of its metabolic end
Ition of its metabolic finish product calcium oxalate crystals in variousItion of its metabolic...
Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and increasingOrmin activates AMPK by inhibiting
Ormin activates AMPK by inhibiting mitochondrial respiratory chain activity and increasingOrmin activates AMPK by...
Ase by six hours, which was then maintained for at least 24 hours.Ase by six
Ase by six hours, which was then maintained for at least 24 hours.Ase by...
Hanism underlying insulin resistance, diabetes, and P2X7 Receptor Antagonist supplier Cardiovascular disease? The prevalent soil
Hanism underlying insulin resistance, diabetes, and P2X7 Receptor Antagonist supplier Cardiovascular disease? The prevalent...
Nt using the observations in Figure 2 mercury exposure of B10.S mice resulted in important
Nt using the observations in Figure 2 mercury exposure of B10.S mice resulted in...
Inactive, as analyzed by Northern blot hybridization (Figure 3C). The findingInactive, as analyzed by Northern
Inactive, as analyzed by Northern blot hybridization (Figure 3C). The findingInactive, as analyzed by...
In w1118, dcerk1, sirt2, and dcerk1.Caspase 6 medchemexpress dsirt2 fly mitochondria. The amountIn w1118, dcerk1,
In w1118, dcerk1, sirt2, and dcerk1.Caspase 6 medchemexpress dsirt2 fly mitochondria. The amountIn w1118,...
Ll has sufficient time to sense the gravity vector, as a result, sensing no weight
Ll has sufficient time to sense the gravity vector, as a result, sensing no...
Dead from EBV may be embalmed (False) Right answers in parenthesis.Pre-workshop (n = 285)
Dead from EBV may be embalmed (False) Right answers in parenthesis.Pre-workshop (n = 285)...
Grams of EPA+DHA every day are suggested below a physician's care. Around 30 million folks
Grams of EPA+DHA every day are suggested below a physician’s care. Around 30 million...
Interaction in between host cells and bacteria. Additionally, we demonstrate thatInteraction between host cells and
Interaction in between host cells and bacteria. Additionally, we demonstrate thatInteraction between host cells...
Sponding band photos from the MEFs. MWAs. The cells were lysedSponding band images from the
Sponding band photos from the MEFs. MWAs. The cells were lysedSponding band images from...
Hances airway fluid absorption. The net result is actually a reduction in airway surface liquid
Hances airway fluid absorption. The net result is actually a reduction in airway surface...
Ration and clonogenic activity K-RAS mutation outcomes in constitutive K-RAS activity, as demonstrated by a
Ration and clonogenic activity K-RAS mutation outcomes in constitutive K-RAS activity, as demonstrated by...
N common first-line regimen in PTCL; having said that, for probably the most frequentN standard
N common first-line regimen in PTCL; having said that, for probably the most frequentN...
Wafosis Co., Tokyo, Japan). The Drosophila heads have been examined by scanningWafosis Co., Tokyo, Japan).
Wafosis Co., Tokyo, Japan). The Drosophila heads have been examined by scanningWafosis Co., Tokyo,...
Topomer analysis. Right here, we present the initial broad mGluR5 drug analysis of ECM protein
Topomer analysis. Right here, we present the initial broad mGluR5 drug analysis of ECM...
Rface with the TT. The nominal CRU model includes a square 7 ?7 array of
Rface with the TT. The nominal CRU model includes a square 7 ?7 array...
T 67 dpi by a recovery phenotype associated having a high quantity of repressed transcripts,
T 67 dpi by a recovery phenotype associated having a high quantity of repressed...
And shRNA-expressing (Turbo-GFP ) cells had been sorted by a fluorescence-activated cell sorterAnd shRNA-expressing (Turbo-GFP
And shRNA-expressing (Turbo-GFP ) cells had been sorted by a fluorescence-activated cell sorterAnd shRNA-expressing...
In w1118, dcerk1, sirt2, and dcerk1.dsirt2 fly mitochondria. The amountIn w1118, dcerk1, sirt2, and dcerk1.dsirt2
In w1118, dcerk1, sirt2, and dcerk1.dsirt2 fly mitochondria. The amountIn w1118, dcerk1, sirt2, and...
Em for three min, which was proven to be enough for equilibration. The information are
Em for three min, which was proven to be enough for equilibration. The information...
Sed by both HEV and CAP. Aquaporins 1, 7 and 11, which regulate tissue fluid,
Sed by both HEV and CAP. Aquaporins 1, 7 and 11, which regulate tissue...
D pre-column. The wavelength was set at 230 nm with a flowD pre-column. The wavelength
D pre-column. The wavelength was set at 230 nm with a flowD pre-column. The...
With a T-DNA organisational structure conducive to effective integration of clonedHaving a T-DNA organisational structure
With a T-DNA organisational structure conducive to effective integration of clonedHaving a T-DNA organisational...
Tion. The mTOR pathway was over-activated in lal-/- ECs, and inhibition of mTOR in lal-/-
Tion. The mTOR pathway was over-activated in lal-/- ECs, and inhibition of mTOR in...
Btained with TNP-ATP as an antagonist. A317491 has no structural similarity to any on the
Btained with TNP-ATP as an antagonist. A317491 has no structural similarity to any on...
U et al.US FDA companion diagnostics co-development requirementan investigator-initiated trial (28) or previously undetected ALK
U et al.US FDA companion diagnostics co-development requirementan investigator-initiated trial (28) or previously undetected...
E and choose cargo. (v) PKCθ manufacturer autophagy receptors including p62 regulateE and select cargo.
E and choose cargo. (v) PKCθ manufacturer autophagy receptors including p62 regulateE and select...
Rnatant was recentrifuged at 16,000 g for 15 min, along with the pellets wereRnatant was
Rnatant was recentrifuged at 16,000 g for 15 min, along with the pellets wereRnatant...
Ready from 8:two L:S could remain in dissolution medium but theReady from 8:two L:S could
Ready from 8:two L:S could remain in dissolution medium but theReady from 8:two L:S...
Ivided into blank control group, model (H. pylori) group in which cells have been treated
Ivided into blank control group, model (H. pylori) group in which cells have been...
Te-sex pheromonal odors: 6-OHDA lesions of DA terminals in this area abolished the hardwired preference
Te-sex pheromonal odors: 6-OHDA lesions of DA terminals in this area abolished the hardwired...
S described over was applied. RNA Interference and Northern Analysis. DeliveryS described above was utilized.
S described over was applied. RNA Interference and Northern Analysis. DeliveryS described above was...
Al handle in excess of drug release. Photodegradable groups are used in the presence of
Al handle in excess of drug release. Photodegradable groups are used in the presence...
E to examine substantial parameter spaces to figure out how mGluR7 medchemexpress unique signalingE to
E to examine substantial parameter spaces to figure out how mGluR7 medchemexpress unique signalingE...
Mbrane association correlates using the assembly status and subunit composition ofMbrane association correlates with the
Mbrane association correlates using the assembly status and subunit composition ofMbrane association correlates with...
Ells/well) cultured for 24 h have been co-cultured with B16-F10 or iB16-shGCR cells (5.06105cells/well; pre-cultured
Ells/well) cultured for 24 h have been co-cultured with B16-F10 or iB16-shGCR cells (5.06105cells/well;...
Isms are required to define potential treatments (e.g. by means of diet programIsms are essential
Isms are required to define potential treatments (e.g. by means of diet programIsms are...
Decline is accounted for Caspase medchemexpress largely by a rise in state 4 respirationDecline is
Decline is accounted for Caspase medchemexpress largely by a rise in state 4 respirationDecline...
Identified as pan-cancer mechanisms of response (PI Score .1.0; Step five). A subset in the
Identified as pan-cancer mechanisms of response (PI Score .1.0; Step five). A subset in...
Erent concentrations (four, eight, 16 and 20 mg/ml). Following the emulsion was added into every
Erent concentrations (four, eight, 16 and 20 mg/ml). Following the emulsion was added into...
Detected a great deal larger amounts of Pb (two,20014,200 ng/g DW) in red and brown
Detected a great deal larger amounts of Pb (two,20014,200 ng/g DW) in red and...
Ced having a new media without GNODE, and cells had been returnedCed having a new
Ced having a new media without GNODE, and cells had been returnedCed having a...
Eral biochemical markers.The-RDS.orgRev Diabet Stud (2013) 10:58-The Assessment of DIABETICEral biochemical markers.The-RDS.orgRev Diabet Stud (2013)
Eral biochemical markers.The-RDS.orgRev Diabet Stud (2013) 10:58-The Assessment of DIABETICEral biochemical markers.The-RDS.orgRev Diabet Stud...
Amino acid deletion related with CdLS [1]. The level of rRNA inAmino acid deletion related
Amino acid deletion related with CdLS . The level of rRNA inAmino acid deletion...
Inactive, as analyzed by Northern blot hybridization (Figure 3C). The gettingInactive, as analyzed by Northern
Inactive, as analyzed by Northern blot hybridization (Figure 3C). The gettingInactive, as analyzed by...
Or comparison, the levels of PEA measured two h immediately after single administration of URB597
Or comparison, the levels of PEA measured two h immediately after single administration of...
Insulin lispro and insulin aspart.23 Other in vitro studies have also shown that insulin aspart
Insulin lispro and insulin aspart.23 Other in vitro studies have also shown that insulin...
Tracer by injection or gavage is much more complicated than simple incubation with ROS probes.
Tracer by injection or gavage is much more complicated than simple incubation with ROS...
Fter treatment method of LPS-stimulated macrophages with the drug I-BET (forty), expression ofFter treatment of
Fter treatment method of LPS-stimulated macrophages with the drug I-BET (forty), expression ofFter treatment...
Thanol. For Western blotting, mouse anti-DDK antibody (OriGene) was made use of atThanol. For Western
Thanol. For Western blotting, mouse anti-DDK antibody (OriGene) was made use of atThanol. For...
Fore, the probability that the NPY Y5 receptor Formulation nasopharyngeal carcinoma within this patient was
Fore, the probability that the NPY Y5 receptor Formulation nasopharyngeal carcinoma within this patient...
Rome, this will incredibly probably influence clinical practice and inform investigators concerning the pathogenesis of
Rome, this will incredibly probably influence clinical practice and inform investigators concerning the pathogenesis...
He manufacturer's directions (R D Systems, Minneapolis, Minnesota). Therapy with cathepsin-B inhibitor CA-074. CA-074 (L-3-trans(Propylcarbamoyl)oxirane-2-carbonyl)-L-isoleucyl-L-proline)
He manufacturer’s directions (R D Systems, Minneapolis, Minnesota). Therapy with cathepsin-B inhibitor CA-074. CA-074...
Chemotherapy at an earlier time point. Future prospective research are warrantedChemotherapy at an earlier time
Chemotherapy at an earlier time point. Future prospective research are warrantedChemotherapy at an earlier...
Ncorporation, normalized to empty vector or nontargeted shRNA management lines. PNcorporation, normalized to empty vector
Ncorporation, normalized to empty vector or nontargeted shRNA management lines. PNcorporation, normalized to empty...
Ion of aggrecan and collagen II, though increasing production of collagen I [Mayne et al.,
Ion of aggrecan and collagen II, though increasing production of collagen I [Mayne et...
Mg/ml) for 3 h at 37 1C. After derivation, iPSCs had been initially grown on
Mg/ml) for 3 h at 37 1C. After derivation, iPSCs had been initially grown...
Ividual shown in Fig. 3).British Journal of NutritionDiscussionOur interest in dietary lactose as an immunomodulatory
Ividual shown in Fig. 3).British Journal of NutritionDiscussionOur interest in dietary lactose as an...
E basic amino acid permease Gap1, on which TORC1-dependent, RspE general amino acid permease Gap1,
E basic amino acid permease Gap1, on which TORC1-dependent, RspE general amino acid permease...
Sis.Evidence-Based Complementary and Option Medicine utilised as inhibitors. The finalSis.Evidence-Based Complementary and Alternative Medicine utilised
Sis.Evidence-Based Complementary and Option Medicine utilised as inhibitors. The finalSis.Evidence-Based Complementary and Alternative Medicine...
Nd: C, 70.89; H, 5.26; N, five.57.NoteASSOCIATED CONTENTS Supporting InformationNMR spectra and crystallographic information.
Nd: C, 70.89; H, 5.26; N, five.57.NoteASSOCIATED CONTENTS Supporting InformationNMR spectra and crystallographic information....
Creased age [20-22]. Similarly, within the present study, the youngest age groups had the highest
Creased age . Similarly, within the present study, the youngest age groups had the...
S having Langerhans cell histiocytosis and acquired chemotherapy [138]. Salmonella infection wasS acquiring Langerhans cell
S having Langerhans cell histiocytosis and acquired chemotherapy . Salmonella infection wasS acquiring Langerhans...
Operties of this molecule, brief half-life, and poor MEK1 site bioavailability make itOperties of this
Operties of this molecule, brief half-life, and poor MEK1 site bioavailability make itOperties of...
Centration-response curves for ET-1 showed enhanced strain generation in the course of isometric vascular smooth
Centration-response curves for ET-1 showed enhanced strain generation in the course of isometric vascular...
Er (Fig. 9A). IK-1 also failed in reporter assays to inhibit R-mediated activation of the
Er (Fig. 9A). IK-1 also failed in reporter assays to inhibit R-mediated activation of...
E created for each and every gene for amplification of promoter and IP Antagonist list
E created for each and every gene for amplification of promoter and IP Antagonist...
He second generation. Conclusions: Thinking of the direct and maternal effects ofHe second generation. Conclusions:
He second generation. Conclusions: Thinking of the direct and maternal effects ofHe second generation....
H di-tert-butyldiaziridinone (1) and Pd(PPh3)4 led to a novel ErbB2/HER2 Formulation sequential allylicH di-tert-butyldiaziridinone (1)
H di-tert-butyldiaziridinone (1) and Pd(PPh3)4 led to a novel ErbB2/HER2 Formulation sequential allylicH di-tert-butyldiaziridinone...
Amide in ameliorating attacks of weakness in HypoPP and hyperkalaemic periodic paralysis will not be
Amide in ameliorating attacks of weakness in HypoPP and hyperkalaemic periodic paralysis will not...
Depth analyses of sulfatases of unknown function that had been identified in a genome-wide look
Depth analyses of sulfatases of unknown function that had been identified in a genome-wide...
And these proteins synergistically amplified LPS-inducible Edn1 CD40 Inhibitor custom synthesis promoter activity (Fig. 8A).
And these proteins synergistically amplified LPS-inducible Edn1 CD40 Inhibitor custom synthesis promoter activity (Fig....
Systemic LPS-induced inflammation, JQ1 increases the susceptibility to DSS-induced colitis.DISCUSSIONTheSystemic LPS-induced inflammation, JQ1 increases the
Systemic LPS-induced inflammation, JQ1 increases the susceptibility to DSS-induced colitis.DISCUSSIONTheSystemic LPS-induced inflammation, JQ1 increases...
In relation to NST complexes have been obtained based on the MDIn relation to NST
In relation to NST complexes have been obtained based on the MDIn relation to...
Ar profile. However, broad adoption of this method has been hindered by an incomplete understanding
Ar profile. However, broad adoption of this method has been hindered by an incomplete...
E patterns were supported by image analyses applying GIS [44] and Daime [32,45] programs and
E patterns were supported by image analyses applying GIS and Daime programs...
Ranial hypertension. Outcomes are provided as medians (IQR).Abbreviations CT: computedRanial hypertension. Results are given as
Ranial hypertension. Outcomes are provided as medians (IQR).Abbreviations CT: computedRanial hypertension. Results are given...
Ordingly, fiber bridges have been explicitly placed on this plane using aOrdingly, fiber bridges have
Ordingly, fiber bridges have been explicitly placed on this plane using aOrdingly, fiber bridges...
O respond to TAM. Chrisholm et al. also showed cytotoxic effects of EGCG alone in
O respond to TAM. Chrisholm et al. also showed cytotoxic effects of EGCG alone...
By contaminated mice was examined employing an experimental strategy described byBy contaminated mice was tested
By contaminated mice was examined employing an experimental strategy described byBy contaminated mice was...
Salvage pathway and hydroxykynurenine inside the de novo pathway, of NADSalvage pathway and hydroxykynurenine inside
Salvage pathway and hydroxykynurenine inside the de novo pathway, of NADSalvage pathway and hydroxykynurenine...
D the consequence of preincubation together with the fibril modulators, fluorescence anisotropy of PC/PG (1:1)
D the consequence of preincubation together with the fibril modulators, fluorescence anisotropy of PC/PG...
Nsgene expression, the severity from the condition in PD-1 Tg miceNsgene expression, the severity of
Nsgene expression, the severity from the condition in PD-1 Tg miceNsgene expression, the severity...
Eral biochemical markers.The-RDS.orgRev Diabet Stud (2013) ten:58-The Review of DIABETICEral biochemical markers.The-RDS.orgRev Diabet Stud (2013)
Eral biochemical markers.The-RDS.orgRev Diabet Stud (2013) ten:58-The Review of DIABETICEral biochemical markers.The-RDS.orgRev Diabet Stud...
Ocols. Proteins have been separated on 4-15 gradient sodium dodecyl sulfate (SDS)-polyacrylamide gels and
Ocols. Proteins have been separated on 4-15 gradient sodium dodecyl sulfate (SDS)-polyacrylamide gels and...
Entation points towards the importance of sustaining the health with the axonal compartment. Whilst it
Entation points towards the importance of sustaining the health with the axonal compartment. Whilst...
By the strategy of Bradford,40 Estrogen receptor drug utilizing bovine serum albumin (BSA) asBy the
By the strategy of Bradford,40 Estrogen receptor drug utilizing bovine serum albumin (BSA) asBy...
Nduces AMPK activation in pancreatic -cells, which results in an increase in KATP channel trafficking
Nduces AMPK activation in pancreatic -cells, which results in an increase in KATP channel...
Tility [57]. They cause membrane rupture by stimulatingPLOS A single | plosone.orgthe ECM remodelling PPARβ/δ
Tility . They cause membrane rupture by stimulatingPLOS A single | plosone.orgthe ECM remodelling...
Dothelial cell monolayer integrity and barrier properties by means of paracrine signaling mechanismsDothelial cell monolayer
Dothelial cell monolayer integrity and barrier properties by means of paracrine signaling mechanismsDothelial cell...
On might be an essential aspect within this metabolic reprogramming (KimOn may very well be
On might be an essential aspect within this metabolic reprogramming (KimOn may very well...
Hat these effects happen as a consequence of various, metformin-induced adjustments in signaling each upstream
Hat these effects happen as a consequence of various, metformin-induced adjustments in signaling each...
Erefore, mixture therapy with milrinone and low-dose landiolol may possibly be aErefore, combination therapy with
Erefore, mixture therapy with milrinone and low-dose landiolol may possibly be aErefore, combination therapy...
Pure water at reflux for 24 h effected clean hydrolysis of yourPure water at reflux
Pure water at reflux for 24 h effected clean hydrolysis of yourPure water at...
E experiments is located in Supporting Data. In experiments on NO/nitrite release from BChE manufacturer
E experiments is located in Supporting Data. In experiments on NO/nitrite release from BChE...
Cavity (Figure 4A) (P 0.01) and an attenuation in level of cartilage destruction within the
Cavity (Figure 4A) (P 0.01) and an attenuation in level of cartilage destruction within...
Ssion construct we observed that PTEN is often a direct target ofSsion construct we observed
Ssion construct we observed that PTEN is often a direct target ofSsion construct we...
Pure water at reflux for 24 h effected clean hydrolysis in thePure water at reflux
Pure water at reflux for 24 h effected clean hydrolysis in thePure water at...