Tion in kefir beverages [34]. Robust correlations involving L. kefiranofaciens and carboxylic
Tion in kefir beverages [34]. Strong correlations involving L. kefiranofaciens and carboxylic acids and ketones linked with cheesy flavors, at the same time as esters associated with fruity flavor, were revealed. Equivalent results had been obtained by Dertli and n [35]. Moreover, Walsh et al. [34] showed that adding L. kefiranofaciens NCFB 2797 to kefir resulted in growing the levels of 2-heptanone and esters.Microorganisms 2021, 9, 2158 Microorganisms 2021, 9,six of 27 6 ofFigure 2. (A) Slimy colonies of L. kefiranofaciens 1P3 in medium containing sucrose [33]. (B) Ropy Figure 2. (A) Slimy colonies of L. kefiranofaciens 1P3 in medium containing sucrose [33]. (B) Ropy behavior of colonies of L. kefiranofaciens ZW3 [21]. behavior of colonies of L. kefiranofaciens ZW3 [21].5. Species and Subspecies Discrimination Phylogeny and shotgun metagenomics sequencing happen to be combined with 5.1. Culture-Dependent Approaches metabolomics, gas chromatography-mass spectrometry (GC-MS) and sensory evaluation to link microbial speciesdiscriminationcompound production in kefir beveragesisolated from Beneficial tools for with volatile of lactobacilli, including L. kefiranofaciens [34]. Powerful correlations amongst L. kefiranofaciensculture-dependent approaches, comprise either phekefir and also other dairy merchandise utilizing and carboxylic acids and ketones associated with cheesy flavors,techniques,as esters associated with fruity flavor, profiles (by SDS-PAGE) notype based at the same time e.g., complete cell protein electrophoretic have been revealed. Equivalent results werebacteria compounds (by Fourier-transform infrared spectroscopy; FT-IR), or and complete obtained by Dertli and n [35]. Additionally, Walsh et al. [34] showed that adding L. kefiranofaciens NCFB 2797 to kefir resulted in increasing the levels of 2molecular methods, such as random amplified polymorphic DNA (RAPD), sequenceheptanone and esters.employing phenylalanyl-tRNA synthase gene (pheS), repetitive element based identification palindromic PCR fingerprinting (rep-PCR) with all the (GTG)5 primer, and 16S rRNA gene se5. Species (reviewed by GLPG-3221 Data Sheet Bengoa et al., 2018) [36]. Recently, colony PCR with L. kefiranofaciens quencing and Subspecies Discrimination species-specific primers (Table 1) 5.1. Culture-Dependent Approaches has also been performed [28].Table 1. Sequences in the species-specific primers and probes targeting Lactobacillus kefiranofaciens as applied in chronologifrom kefir as well as other dairy products making use of culture-dependent approaches, comprise either cal order.PCR Sort Species-specific PCRUseful tools for discrimination of lactobacilli, such as L. kefiranofaciens isolatedReal-time PCRphenotype based methods, e.g., complete cell protein electrophoretic profiles (by SDS-PAGE) and whole bacteria compounds (by Fourier-transform infrared spectroscopy; FT-IR), or Primer/Probe Sequence (five -3 ) Combretastatin A-1 Cell Cycle/DNA Damage Reference molecular procedures, like random amplified polymorphic DNA (RAPD), sequence[20] Forward (R2C2-16SF) TAAGAAAGCA GTTCGCATGA ACAG primarily based identification utilizing phenylalanyl-tRNA synthase gene (pheS), repetitive element Patent US Reverse (R2C2-16SR) fingerprinting (rep-PCR) together with the (GTG)5 primer, and2009/0130.072 gene GGGACTTTGT ATCTCTACAA ATGG palindromic PCR 16S rRNA A1 sequencing (reviewed by Bengoa et al., 2018) [36]. Lately, colony PCR with L. Forward CAGTTCGCATGAACAGCTTTTAA kefiranofaciens species-specific primers (Table 1) has also been performed [28]. [37] Reverse GCACCGCGGGTCCATProbe FAM-CGCAAGCTGTCGCTAA-TAMRAColony species-specif.
